Incidental Mutation 'R6004:Ppp2r2b'
ID482046
Institutional Source Beutler Lab
Gene Symbol Ppp2r2b
Ensembl Gene ENSMUSG00000024500
Gene Nameprotein phosphatase 2, regulatory subunit B, beta
SynonymsSCA12, 6330404L05Rik, 2900026H06Rik, E130009M08Rik, PR55-BETA, PP2A-PR55B
MMRRC Submission 044182-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6004 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location42637432-43059471 bp(-) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) T to C at 43059159 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000025377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025377]
Predicted Effect probably null
Transcript: ENSMUST00000025377
SMART Domains Protein: ENSMUSP00000025377
Gene: ENSMUSG00000024500

DomainStartEndE-ValueType
WD40 14 55 6.42e-1 SMART
WD40 82 122 3.7e0 SMART
WD40 164 203 1.66e0 SMART
WD40 214 254 1.38e1 SMART
WD40 273 311 5.7e1 SMART
Blast:WD40 315 369 6e-26 BLAST
WD40 405 442 1.33e1 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 96.8%
  • 20x: 89.1%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the phosphatase 2 regulatory subunit B family. Protein phosphatase 2 is one of the four major Ser/Thr phosphatases, and it is implicated in the negative control of cell growth and division. It consists of a common heteromeric core enzyme, which is composed of a catalytic subunit and a constant regulatory subunit, that associates with a variety of regulatory subunits. The B regulatory subunit might modulate substrate selectivity and catalytic activity. This gene encodes a beta isoform of the regulatory subunit B55 subfamily. Defects in this gene cause autosomal dominant spinocerebellar ataxia 12 (SCA12), a disease caused by degeneration of the cerebellum, sometimes involving the brainstem and spinal cord, and in resulting in poor coordination of speech and body movements. Multiple alternatively spliced variants, which encode different isoforms, have been identified for this gene. The 5' UTR of some of these variants includes a CAG trinucleotide repeat sequence (7-28 copies) that can be expanded to 55-78 copies in cases of SCA12. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp6 C T 3: 97,175,681 A336V probably benign Het
Adam5 T A 8: 24,781,669 Y574F probably benign Het
Arl6 A T 16: 59,623,894 W80R probably damaging Het
Arntl A T 7: 113,280,727 D22V probably damaging Het
Cars2 A G 8: 11,547,743 I111T probably damaging Het
Chrd T C 16: 20,735,237 L317S possibly damaging Het
Cyp4a12b A G 4: 115,433,467 D262G probably benign Het
Dcaf6 A G 1: 165,388,685 S450P probably benign Het
Dnah3 T C 7: 120,086,297 D164G probably benign Het
Gpx6 A C 13: 21,319,069 T218P probably benign Het
Htr1f T C 16: 64,925,876 N351S probably damaging Het
Idua A G 5: 108,680,644 E241G probably benign Het
Ighv14-2 T A 12: 113,994,635 Q62L probably damaging Het
Ighv1-65 C T 12: 115,532,436 noncoding transcript Het
Inpp4a T C 1: 37,372,370 S372P probably damaging Het
Itgax A T 7: 128,131,452 H114L probably damaging Het
Lama2 A T 10: 27,235,785 F746L probably benign Het
Lrrc37a C T 11: 103,502,536 V688M possibly damaging Het
Ltbp2 A G 12: 84,876,149 V28A probably benign Het
Mill2 A T 7: 18,856,538 D166V probably benign Het
Mroh2a G A 1: 88,248,655 C982Y probably damaging Het
Msh3 T A 13: 92,342,414 probably null Het
Myh15 A T 16: 49,159,699 M1395L probably benign Het
Npepps T C 11: 97,223,124 E642G probably benign Het
Nrg4 T C 9: 55,259,383 T68A possibly damaging Het
Olfr1016 A T 2: 85,799,382 V296E probably damaging Het
Olfr1130 T A 2: 87,607,909 F174I probably damaging Het
Olfr1313 G T 2: 112,072,026 L186I probably damaging Het
Olfr32 T C 2: 90,138,999 N47D probably benign Het
Olfr792 T A 10: 129,540,890 Y118N probably benign Het
Olfr890 A G 9: 38,143,960 K270R probably damaging Het
Otogl T A 10: 107,879,529 I429F probably damaging Het
Pank4 G T 4: 154,977,221 G532C probably damaging Het
Plce1 A G 19: 38,721,871 T1150A probably damaging Het
Prkrip1 A G 5: 136,197,782 M68T probably damaging Het
Psme4 T A 11: 30,856,896 probably benign Het
Raet1d T A 10: 22,371,394 I123N probably damaging Het
Rp1 T G 1: 4,197,585 T825P unknown Het
Rttn T C 18: 89,021,692 I839T probably damaging Het
Sgo2b G A 8: 63,926,673 Q1042* probably null Het
Skint11 A G 4: 114,231,728 T240A probably benign Het
Speg A T 1: 75,415,603 K1382* probably null Het
Srsf7 A T 17: 80,205,853 D68E probably damaging Het
Stag3 A T 5: 138,289,206 D131V probably damaging Het
Strip2 T A 6: 29,926,571 C152S probably damaging Het
Timm44 G T 8: 4,267,747 D191E probably benign Het
Tlnrd1 A G 7: 83,882,779 V148A probably damaging Het
Trp63 T C 16: 25,763,396 probably null Het
Tusc3 G C 8: 39,071,406 G200R probably damaging Het
Vmn2r10 T G 5: 108,999,078 N448T probably benign Het
Vmn2r50 G A 7: 10,050,059 R163C probably benign Het
Vmn2r53 T C 7: 12,582,401 H497R probably benign Het
Vps39 A G 2: 120,345,650 V83A possibly damaging Het
Ylpm1 A T 12: 85,029,084 N861I possibly damaging Het
Zfp712 A G 13: 67,041,705 C253R probably damaging Het
Zfp930 A G 8: 69,227,904 T84A probably benign Het
Other mutations in Ppp2r2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00825:Ppp2r2b APN 18 42645775 missense probably damaging 0.99
IGL01999:Ppp2r2b APN 18 42645723 utr 3 prime probably benign
IGL02610:Ppp2r2b APN 18 42648775 splice site probably benign
IGL02733:Ppp2r2b APN 18 42648728 missense possibly damaging 0.96
IGL02899:Ppp2r2b APN 18 42645809 missense probably damaging 1.00
Degradation UTSW 18 42688338 missense probably benign 0.27
R0737:Ppp2r2b UTSW 18 43059192 missense probably benign
R1459:Ppp2r2b UTSW 18 42737990 missense probably damaging 1.00
R1616:Ppp2r2b UTSW 18 42688310 missense probably benign 0.32
R1635:Ppp2r2b UTSW 18 43059210 missense probably benign 0.01
R3435:Ppp2r2b UTSW 18 42741109 missense possibly damaging 0.48
R4204:Ppp2r2b UTSW 18 42738050 missense probably benign
R4301:Ppp2r2b UTSW 18 42898746 missense probably null
R5062:Ppp2r2b UTSW 18 42688461 missense possibly damaging 0.48
R5147:Ppp2r2b UTSW 18 42645877 missense probably benign 0.00
R5207:Ppp2r2b UTSW 18 42688352 missense probably damaging 1.00
R5277:Ppp2r2b UTSW 18 42741142 missense probably damaging 1.00
R6528:Ppp2r2b UTSW 18 42688338 missense probably benign 0.27
R6735:Ppp2r2b UTSW 18 42688588 splice site probably null
R7521:Ppp2r2b UTSW 18 43059177 missense probably benign
R7831:Ppp2r2b UTSW 18 42701532 missense probably benign
R8405:Ppp2r2b UTSW 18 42645740 missense probably benign 0.00
R8486:Ppp2r2b UTSW 18 42898804 missense probably benign 0.17
Z1177:Ppp2r2b UTSW 18 42648693 missense probably benign 0.04
Z1177:Ppp2r2b UTSW 18 42688423 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCAGCTTAGAGATCACCTTTG -3'
(R):5'- ATGTAGCCAGCTTTCAAGGC -3'

Sequencing Primer
(F):5'- GAGATCACCTTTGCAACAGTATCCTG -3'
(R):5'- CCAGCTTTCAAGGCTGAGAGAATC -3'
Posted On2017-06-27