Incidental Mutation 'R6016:Slc38a8'
ID482048
Institutional Source Beutler Lab
Gene Symbol Slc38a8
Ensembl Gene ENSMUSG00000034224
Gene Namesolute carrier family 38, member 8
SynonymsLOC234788
MMRRC Submission 043255-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R6016 (G1)
Quality Score169.009
Status Not validated
Chromosome8
Chromosomal Location119479602-119501698 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 119494305 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000119987 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036748] [ENSMUST00000036748] [ENSMUST00000133821] [ENSMUST00000138061] [ENSMUST00000138061] [ENSMUST00000138061] [ENSMUST00000138061]
Predicted Effect probably null
Transcript: ENSMUST00000036748
SMART Domains Protein: ENSMUSP00000038438
Gene: ENSMUSG00000034224

DomainStartEndE-ValueType
Pfam:Aa_trans 22 429 3.7e-58 PFAM
Pfam:Trp_Tyr_perm 23 264 1.1e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000036748
SMART Domains Protein: ENSMUSP00000038438
Gene: ENSMUSG00000034224

DomainStartEndE-ValueType
Pfam:Aa_trans 22 429 3.7e-58 PFAM
Pfam:Trp_Tyr_perm 23 264 1.1e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125594
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132838
SMART Domains Protein: ENSMUSP00000121251
Gene: ENSMUSG00000034224

DomainStartEndE-ValueType
Pfam:Aa_trans 39 289 1.1e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133821
SMART Domains Protein: ENSMUSP00000123094
Gene: ENSMUSG00000034224

DomainStartEndE-ValueType
Pfam:Trp_Tyr_perm 22 163 2.1e-10 PFAM
Pfam:Aa_trans 22 165 3.5e-21 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000138061
SMART Domains Protein: ENSMUSP00000119987
Gene: ENSMUSG00000034224

DomainStartEndE-ValueType
Pfam:Aa_trans 22 202 2.2e-25 PFAM
Pfam:Trp_Tyr_perm 23 196 1.2e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000138061
SMART Domains Protein: ENSMUSP00000119987
Gene: ENSMUSG00000034224

DomainStartEndE-ValueType
Pfam:Aa_trans 22 202 2.2e-25 PFAM
Pfam:Trp_Tyr_perm 23 196 1.2e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000138061
SMART Domains Protein: ENSMUSP00000119987
Gene: ENSMUSG00000034224

DomainStartEndE-ValueType
Pfam:Aa_trans 22 202 2.2e-25 PFAM
Pfam:Trp_Tyr_perm 23 196 1.2e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000138061
SMART Domains Protein: ENSMUSP00000119987
Gene: ENSMUSG00000034224

DomainStartEndE-ValueType
Pfam:Aa_trans 22 202 2.2e-25 PFAM
Pfam:Trp_Tyr_perm 23 196 1.2e-9 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.0%
  • 20x: 90.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a putative sodium-dependent amino-acid/proton antiporter. The protein has eleven transmembrane domains, an extracellular N-terminus and an intracellular C-terminal tail. The protein is a member of the SLC38 sodium-coupled neutral amino acid transporter family of proteins. Mutations in this gene result in foveal hypoplasia with or without optic nerve misrouting and/or anterior segment dysgenesis. [provided by RefSeq, May 2014]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apol9b T C 15: 77,735,858 S285P probably damaging Het
Casz1 C A 4: 148,934,584 N447K probably damaging Het
Cltb T C 13: 54,606,667 T71A possibly damaging Het
Dcaf12 A G 4: 41,313,267 F93L probably damaging Het
Dnah5 T C 15: 28,327,884 Y2135H probably damaging Het
Entpd2 C T 2: 25,398,556 R191W probably damaging Het
Gm17067 G T 7: 42,708,230 P283T probably benign Het
Gm3250 A G 10: 77,782,533 probably benign Het
Gne T C 4: 44,039,063 E532G probably damaging Het
Gsdmc3 T G 15: 63,868,412 D86A probably benign Het
Hs3st2 A G 7: 121,500,699 H256R probably damaging Het
Il19 T A 1: 130,935,981 D16V probably damaging Het
Lats2 A T 14: 57,734,175 N14K probably damaging Het
Mill2 G T 7: 18,856,448 S151I probably benign Het
Ncapg2 G A 12: 116,426,607 R392H probably damaging Het
Nop56 T C 2: 130,276,625 probably null Het
Olfr1344 A T 7: 6,440,614 H238L probably benign Het
Olfr467 A T 7: 107,815,012 I143F probably benign Het
Olfr761 A T 17: 37,952,076 V316D probably benign Het
Pde1a T C 2: 79,865,062 R446G probably benign Het
Pes1 T A 11: 3,978,004 M552K possibly damaging Het
Plxnb2 T A 15: 89,161,022 T1074S possibly damaging Het
Psg23 G T 7: 18,612,187 H194Q probably benign Het
Rprd2 A G 3: 95,787,373 V116A probably damaging Het
Shkbp1 A G 7: 27,354,401 V124A possibly damaging Het
Slitrk6 A G 14: 110,750,526 V583A probably benign Het
Sptbn5 G T 2: 120,050,092 noncoding transcript Het
Stab1 A T 14: 31,158,993 I614N probably damaging Het
Tgm6 A G 2: 130,141,228 T246A probably damaging Het
Tnks1bp1 T C 2: 85,052,390 L187P probably damaging Het
Vmn1r157 A G 7: 22,761,847 R51G possibly damaging Het
Vmn2r68 A T 7: 85,222,245 I610K probably damaging Het
Other mutations in Slc38a8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00763:Slc38a8 APN 8 119494219 missense probably benign 0.01
IGL02167:Slc38a8 APN 8 119487360 missense probably benign 0.03
IGL02565:Slc38a8 APN 8 119485561 missense probably damaging 1.00
IGL02899:Slc38a8 APN 8 119485543 missense probably benign 0.34
IGL03177:Slc38a8 APN 8 119485512 missense probably damaging 1.00
IGL03282:Slc38a8 APN 8 119499716 missense probably damaging 0.99
R1109:Slc38a8 UTSW 8 119482655 missense probably benign
R1116:Slc38a8 UTSW 8 119496133 missense probably damaging 1.00
R2247:Slc38a8 UTSW 8 119485650 missense probably benign 0.00
R4964:Slc38a8 UTSW 8 119482684 splice site probably null
R5294:Slc38a8 UTSW 8 119494289 missense probably damaging 1.00
R5303:Slc38a8 UTSW 8 119486041 missense possibly damaging 0.66
R5430:Slc38a8 UTSW 8 119494220 missense probably benign 0.16
R5643:Slc38a8 UTSW 8 119480749 makesense probably null
R7346:Slc38a8 UTSW 8 119499815 nonsense probably null
R7425:Slc38a8 UTSW 8 119485588 missense possibly damaging 0.89
R7502:Slc38a8 UTSW 8 119501081 missense possibly damaging 0.60
R8081:Slc38a8 UTSW 8 119485530 missense possibly damaging 0.54
Predicted Primers PCR Primer
(F):5'- TTGGCTTTGTCCTCAGCAAAC -3'
(R):5'- AAAGAGATATCCCAGTTGCCCTC -3'

Sequencing Primer
(F):5'- TTTGTCCTCAGCAAACCCCAGAG -3'
(R):5'- AGTTGCCCTCCCCAAGG -3'
Posted On2017-06-27