Incidental Mutation 'R6020:Wee2'
ID 482052
Institutional Source Beutler Lab
Gene Symbol Wee2
Ensembl Gene ENSMUSG00000037159
Gene Name WEE1 homolog 2 (S. pombe)
Synonyms Wee1b, LOC381759
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6020 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 40416022-40443747 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) T to A at 40426554 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000144628 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038907] [ENSMUST00000202464]
AlphaFold Q66JT0
Predicted Effect probably null
Transcript: ENSMUST00000038907
SMART Domains Protein: ENSMUSP00000038754
Gene: ENSMUSG00000037159

DomainStartEndE-ValueType
low complexity region 117 128 N/A INTRINSIC
Pfam:Pkinase 208 481 3.6e-51 PFAM
Pfam:Pkinase_Tyr 209 478 9.6e-25 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000202464
SMART Domains Protein: ENSMUSP00000144628
Gene: ENSMUSG00000037159

DomainStartEndE-ValueType
low complexity region 117 128 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 C A 11: 110,036,439 (GRCm39) V557F possibly damaging Het
Abi3 A T 11: 95,732,851 (GRCm39) L41* probably null Het
Actn1 C A 12: 80,221,229 (GRCm39) probably null Het
Adamts15 G T 9: 30,813,358 (GRCm39) R936S probably benign Het
Angel2 T C 1: 190,665,068 (GRCm39) S22P probably benign Het
Ank2 T G 3: 126,740,470 (GRCm39) probably benign Het
Astn1 A G 1: 158,337,563 (GRCm39) D423G probably damaging Het
Casp9 A G 4: 141,523,849 (GRCm39) D78G probably damaging Het
Cbr4 A G 8: 61,940,887 (GRCm39) D2G probably benign Het
Ccdc8 T A 7: 16,730,506 (GRCm39) L665H probably damaging Het
Cdh23 T A 10: 60,167,105 (GRCm39) N1847I probably damaging Het
Cnst T C 1: 179,437,440 (GRCm39) W335R probably benign Het
Ddr2 T A 1: 169,832,671 (GRCm39) I130F probably benign Het
Dnah2 C T 11: 69,391,665 (GRCm39) A677T probably benign Het
Dzip3 C A 16: 48,772,205 (GRCm39) W488L probably damaging Het
Ephb3 T G 16: 21,040,763 (GRCm39) I637S probably damaging Het
Etv3 A G 3: 87,436,671 (GRCm39) D142G probably benign Het
Fabp5 C T 3: 10,081,149 (GRCm39) T126I probably benign Het
Fam13b A C 18: 34,627,827 (GRCm39) Y125D probably damaging Het
Fsip2 C A 2: 82,822,471 (GRCm39) P6068Q probably damaging Het
Gm11232 A G 4: 71,674,905 (GRCm39) F199S possibly damaging Het
Gm5493 A G 17: 22,967,034 (GRCm39) K57E probably benign Het
Gm7334 A G 17: 51,006,265 (GRCm39) M184V probably benign Het
Gm9894 T C 13: 67,911,954 (GRCm39) noncoding transcript Het
Gpd2 T A 2: 57,254,525 (GRCm39) N674K probably benign Het
H2-M10.6 A G 17: 37,123,959 (GRCm39) Y141C probably damaging Het
Heatr5a C T 12: 51,931,110 (GRCm39) E1796K probably benign Het
Hexim2 A G 11: 103,029,118 (GRCm39) T57A probably benign Het
Hrg A T 16: 22,773,268 (GRCm39) N134Y probably damaging Het
Hsd17b12 T C 2: 93,864,322 (GRCm39) T262A probably damaging Het
Irak3 G T 10: 119,979,042 (GRCm39) P470T probably damaging Het
Itgbl1 A T 14: 124,083,977 (GRCm39) D285V probably damaging Het
Kcp A T 6: 29,502,863 (GRCm39) V164E probably benign Het
Klhdc7b T A 15: 89,272,589 (GRCm39) M1157K probably damaging Het
Lcor G A 19: 41,571,986 (GRCm39) G247D possibly damaging Het
Mdc1 G A 17: 36,159,525 (GRCm39) G635D probably benign Het
Mdc1 A G 17: 36,168,464 (GRCm39) K1690R probably benign Het
Mpp3 A T 11: 101,909,365 (GRCm39) probably benign Het
Ncor2 G T 5: 125,097,075 (GRCm39) H2285N probably benign Het
Neb T A 2: 52,147,839 (GRCm39) T2727S probably benign Het
Nkx6-2 T C 7: 139,161,483 (GRCm39) D234G possibly damaging Het
Nlrp9c T C 7: 26,084,150 (GRCm39) I476M probably benign Het
Nrsn1 T G 13: 25,437,355 (GRCm39) Q191P probably damaging Het
Or14j10 A T 17: 37,934,858 (GRCm39) S223T possibly damaging Het
Or1e30 C T 11: 73,678,378 (GRCm39) L205F probably benign Het
Or51ag1 T A 7: 103,156,006 (GRCm39) H49L probably benign Het
Patl1 T G 19: 11,914,718 (GRCm39) L623R probably damaging Het
Pdc T C 1: 150,209,117 (GRCm39) I200T probably benign Het
Pdzk1 A G 3: 96,775,742 (GRCm39) D370G probably benign Het
Pglyrp3 A T 3: 91,938,841 (GRCm39) I339F probably damaging Het
Plxnb1 T C 9: 108,945,679 (GRCm39) V2070A probably damaging Het
Poln G A 5: 34,266,775 (GRCm39) R461C probably damaging Het
Prl2b1 C A 13: 27,567,491 (GRCm39) V218L probably damaging Het
Pygl T C 12: 70,263,428 (GRCm39) D55G probably damaging Het
Rif1 C G 2: 51,985,856 (GRCm39) L614V probably damaging Het
Rnd2 C T 11: 101,359,825 (GRCm39) L57F probably damaging Het
Rsrp1 T C 4: 134,651,692 (GRCm39) F152S probably damaging Het
Sim2 T C 16: 93,898,110 (GRCm39) S115P probably damaging Het
Slc17a1 T A 13: 24,059,593 (GRCm39) I108K possibly damaging Het
Slc30a8 A G 15: 52,189,054 (GRCm39) D223G probably damaging Het
Slc39a4 A T 15: 76,500,342 (GRCm39) N69K probably benign Het
Slc51a T G 16: 32,298,584 (GRCm39) T58P probably damaging Het
Slc7a14 T C 3: 31,278,261 (GRCm39) H448R probably benign Het
Smc3 G A 19: 53,613,594 (GRCm39) probably null Het
Sox6 A T 7: 115,085,863 (GRCm39) D659E probably damaging Het
Stard9 GCCC GCC 2: 120,524,196 (GRCm39) probably null Het
Tsr1 C T 11: 74,791,119 (GRCm39) probably null Het
Ttc12 T C 9: 49,354,422 (GRCm39) K565E probably damaging Het
Ube4b A T 4: 149,452,768 (GRCm39) V386E probably benign Het
Ush2a T A 1: 188,460,293 (GRCm39) probably null Het
Usp5 C A 6: 124,794,576 (GRCm39) probably benign Het
Vmn1r216 T C 13: 23,284,105 (GRCm39) F263L probably benign Het
Vmn2r88 T A 14: 51,655,606 (GRCm39) L606* probably null Het
Zfhx3 T C 8: 109,519,159 (GRCm39) Y94H probably damaging Het
Zfp385c G A 11: 100,523,594 (GRCm39) P120L probably benign Het
Zscan4-ps3 T C 7: 11,344,228 (GRCm39) F62S probably damaging Het
Other mutations in Wee2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Wee2 APN 6 40,438,995 (GRCm39) missense probably damaging 1.00
IGL01096:Wee2 APN 6 40,440,187 (GRCm39) missense probably benign 0.00
IGL01978:Wee2 APN 6 40,432,087 (GRCm39) missense probably damaging 1.00
IGL03026:Wee2 APN 6 40,438,915 (GRCm39) missense probably benign 0.00
IGL03091:Wee2 APN 6 40,438,968 (GRCm39) missense probably benign 0.02
IGL03350:Wee2 APN 6 40,426,665 (GRCm39) missense probably damaging 1.00
IGL03352:Wee2 APN 6 40,429,589 (GRCm39) critical splice donor site probably null
R0420:Wee2 UTSW 6 40,433,929 (GRCm39) missense probably benign 0.04
R0506:Wee2 UTSW 6 40,440,187 (GRCm39) missense probably benign 0.04
R1205:Wee2 UTSW 6 40,420,875 (GRCm39) start gained probably benign
R1702:Wee2 UTSW 6 40,441,135 (GRCm39) missense probably benign 0.04
R3982:Wee2 UTSW 6 40,432,175 (GRCm39) missense possibly damaging 0.86
R3983:Wee2 UTSW 6 40,432,175 (GRCm39) missense possibly damaging 0.86
R5946:Wee2 UTSW 6 40,440,146 (GRCm39) missense probably null 1.00
R6127:Wee2 UTSW 6 40,426,701 (GRCm39) missense probably damaging 1.00
R6189:Wee2 UTSW 6 40,426,617 (GRCm39) missense probably damaging 1.00
R6342:Wee2 UTSW 6 40,421,189 (GRCm39) missense probably benign 0.05
R6347:Wee2 UTSW 6 40,432,039 (GRCm39) missense probably damaging 1.00
R6350:Wee2 UTSW 6 40,432,039 (GRCm39) missense probably damaging 1.00
R6513:Wee2 UTSW 6 40,429,553 (GRCm39) missense probably benign 0.00
R7091:Wee2 UTSW 6 40,438,936 (GRCm39) missense probably benign 0.00
R8258:Wee2 UTSW 6 40,421,114 (GRCm39) missense probably benign 0.00
R8259:Wee2 UTSW 6 40,421,114 (GRCm39) missense probably benign 0.00
R8463:Wee2 UTSW 6 40,420,914 (GRCm39) start codon destroyed probably null 1.00
R8853:Wee2 UTSW 6 40,441,200 (GRCm39) missense probably benign 0.07
R9028:Wee2 UTSW 6 40,421,189 (GRCm39) missense probably benign
R9170:Wee2 UTSW 6 40,437,977 (GRCm39) missense probably benign 0.07
R9231:Wee2 UTSW 6 40,440,089 (GRCm39) missense probably damaging 1.00
R9394:Wee2 UTSW 6 40,433,878 (GRCm39) missense probably damaging 0.96
R9474:Wee2 UTSW 6 40,432,044 (GRCm39) nonsense probably null
R9493:Wee2 UTSW 6 40,421,057 (GRCm39) missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- ACCGATTCTTGTGTGGATTCAAG -3'
(R):5'- GCACTTGCCCAAAGGAGTTC -3'

Sequencing Primer
(F):5'- GAATGAGTCTAGAATTCTGTATGCG -3'
(R):5'- TTGCCCAAAGGAGTTCTCAGAAAC -3'
Posted On 2017-06-27