Mutagenetix > Incidental Mutation

Incidental Mutation 'R6020:Usp5'

482053

Institutional Source

Beutler Lab

Gene Symbol

Usp5

Ensembl Gene

ENSMUSG00000038429

Gene Name

ubiquitin specific peptidase 5 (isopeptidase T)

Synonyms

Ucht

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6020 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

124815019-124829484 bp(-) (GRCm38)

Type of Mutation

unclassified

DNA Base Change (assembly)

C to A at 124817613 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000130858 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047510] [ENSMUST00000047510] [ENSMUST00000122110] [ENSMUST00000122110] [ENSMUST00000149610] [ENSMUST00000172132]

AlphaFold

P56399

Predicted Effect

probably benign
Transcript: ENSMUST00000047510

SMART Domains

Protein: ENSMUSP00000041299
Gene: ENSMUSG00000038429

Domain	Start	End	E-Value	Type
low complexity region	2	11	N/A	INTRINSIC
Blast:ZnF_UBP	29	78	4e-19	BLAST
ZnF_UBP	198	253	6.47e-27	SMART
low complexity region	497	516	N/A	INTRINSIC
UBA	656	694	3.12e-7	SMART
UBA	724	761	8.63e-10	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000047510

SMART Domains

Protein: ENSMUSP00000041299
Gene: ENSMUSG00000038429

Domain	Start	End	E-Value	Type
low complexity region	2	11	N/A	INTRINSIC
Blast:ZnF_UBP	29	78	4e-19	BLAST
ZnF_UBP	198	253	6.47e-27	SMART
low complexity region	497	516	N/A	INTRINSIC
UBA	656	694	3.12e-7	SMART
UBA	724	761	8.63e-10	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000122110

SMART Domains

Protein: ENSMUSP00000114000
Gene: ENSMUSG00000038429

Domain	Start	End	E-Value	Type
low complexity region	2	11	N/A	INTRINSIC
Blast:ZnF_UBP	29	78	4e-19	BLAST
ZnF_UBP	198	253	6.47e-27	SMART
low complexity region	497	516	N/A	INTRINSIC
UBA	633	671	3.12e-7	SMART
UBA	701	738	8.63e-10	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000122110

SMART Domains

Protein: ENSMUSP00000114000
Gene: ENSMUSG00000038429

Domain	Start	End	E-Value	Type
low complexity region	2	11	N/A	INTRINSIC
Blast:ZnF_UBP	29	78	4e-19	BLAST
ZnF_UBP	198	253	6.47e-27	SMART
low complexity region	497	516	N/A	INTRINSIC
UBA	633	671	3.12e-7	SMART
UBA	701	738	8.63e-10	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129159

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131805

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139716

Predicted Effect

probably benign
Transcript: ENSMUST00000149610

SMART Domains

Protein: ENSMUSP00000125292
Gene: ENSMUSG00000023456

Domain	Start	End	E-Value	Type
Pfam:TIM	1	163	1.1e-65	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154189

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154883

Predicted Effect

probably benign
Transcript: ENSMUST00000172132

SMART Domains

Protein: ENSMUSP00000130858
Gene: ENSMUSG00000023456

Domain	Start	End	E-Value	Type
Pfam:TIM	57	295	9.2e-86	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000204602

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.8%
20x: 93.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ubiquitin (see MIM 191339)-dependent proteolysis is a complex pathway of protein metabolism implicated in such diverse cellular functions as maintenance of chromatin structure, receptor function, and degradation of abnormal proteins. A late step of the process involves disassembly of the polyubiquitin chains on degraded proteins into ubiquitin monomers. USP5 disassembles branched polyubiquitin chains by a sequential exo mechanism, starting at the proximal end of the chain (Wilkinson et al., 1995 [PubMed 7578059]).[supplied by OMIM, Mar 2010]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E7. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca9	C	A	11: 110,145,613	V557F	possibly damaging	Het
Abi3	A	T	11: 95,842,025	L41*	probably null	Het
Actn1	C	A	12: 80,174,455		probably null	Het
Adamts15	G	T	9: 30,902,062	R936S	probably benign	Het
Angel2	T	C	1: 190,932,871	S22P	probably benign	Het
Ank2	T	G	3: 126,946,821		probably benign	Het
Astn1	A	G	1: 158,509,993	D423G	probably damaging	Het
Casp9	A	G	4: 141,796,538	D78G	probably damaging	Het
Cbr4	A	G	8: 61,487,853	D2G	probably benign	Het
Ccdc8	T	A	7: 16,996,581	L665H	probably damaging	Het
Cdh23	T	A	10: 60,331,326	N1847I	probably damaging	Het
Cnst	T	C	1: 179,609,875	W335R	probably benign	Het
Ddr2	T	A	1: 170,005,102	I130F	probably benign	Het
Dnah2	C	T	11: 69,500,839	A677T	probably benign	Het
Dzip3	C	A	16: 48,951,842	W488L	probably damaging	Het
Ephb3	T	G	16: 21,222,013	I637S	probably damaging	Het
Etv3	A	G	3: 87,529,364	D142G	probably benign	Het
Fabp5	C	T	3: 10,016,089	T126I	probably benign	Het
Fam13b	A	C	18: 34,494,774	Y125D	probably damaging	Het
Fsip2	C	A	2: 82,992,127	P6068Q	probably damaging	Het
Gm11232	A	G	4: 71,756,668	F199S	possibly damaging	Het
Gm340	G	A	19: 41,583,547	G247D	possibly damaging	Het
Gm5493	A	G	17: 22,748,061	K57E	probably benign	Het
Gm7334	A	G	17: 50,699,237	M184V	probably benign	Het
Gm9894	T	C	13: 67,763,835		noncoding transcript	Het
Gpd2	T	A	2: 57,364,513	N674K	probably benign	Het
H2-M10.6	A	G	17: 36,813,067	Y141C	probably damaging	Het
Heatr5a	C	T	12: 51,884,327	E1796K	probably benign	Het
Hexim2	A	G	11: 103,138,292	T57A	probably benign	Het
Hrg	A	T	16: 22,954,518	N134Y	probably damaging	Het
Hsd17b12	T	C	2: 94,033,977	T262A	probably damaging	Het
Irak3	G	T	10: 120,143,137	P470T	probably damaging	Het
Itgbl1	A	T	14: 123,846,565	D285V	probably damaging	Het
Kcp	A	T	6: 29,502,864	V164E	probably benign	Het
Klhdc7b	T	A	15: 89,388,386	M1157K	probably damaging	Het
Mdc1	G	A	17: 35,848,633	G635D	probably benign	Het
Mdc1	A	G	17: 35,857,572	K1690R	probably benign	Het
Mpp3	A	T	11: 102,018,539		probably benign	Het
Ncor2	G	T	5: 125,020,011	H2285N	probably benign	Het
Neb	T	A	2: 52,257,827	T2727S	probably benign	Het
Nkx6-2	T	C	7: 139,581,567	D234G	possibly damaging	Het
Nlrp9c	T	C	7: 26,384,725	I476M	probably benign	Het
Nrsn1	T	G	13: 25,253,372	Q191P	probably damaging	Het
Olfr116	A	T	17: 37,623,967	S223T	possibly damaging	Het
Olfr390	C	T	11: 73,787,552	L205F	probably benign	Het
Olfr610	T	A	7: 103,506,799	H49L	probably benign	Het
Patl1	T	G	19: 11,937,354	L623R	probably damaging	Het
Pdc	T	C	1: 150,333,366	I200T	probably benign	Het
Pdzk1	A	G	3: 96,868,426	D370G	probably benign	Het
Pglyrp3	A	T	3: 92,031,534	I339F	probably damaging	Het
Plxnb1	T	C	9: 109,116,611	V2070A	probably damaging	Het
Poln	G	A	5: 34,109,431	R461C	probably damaging	Het
Prl2b1	C	A	13: 27,383,508	V218L	probably damaging	Het
Pygl	T	C	12: 70,216,654	D55G	probably damaging	Het
Rif1	C	G	2: 52,095,844	L614V	probably damaging	Het
Rnd2	C	T	11: 101,468,999	L57F	probably damaging	Het
RP24-351P7.8	T	C	7: 11,610,301	F62S	probably damaging	Het
Rsrp1	T	C	4: 134,924,381	F152S	probably damaging	Het
Sim2	T	C	16: 94,097,251	S115P	probably damaging	Het
Slc17a1	T	A	13: 23,875,610	I108K	possibly damaging	Het
Slc30a8	A	G	15: 52,325,658	D223G	probably damaging	Het
Slc39a4	A	T	15: 76,616,142	N69K	probably benign	Het
Slc51a	T	G	16: 32,479,766	T58P	probably damaging	Het
Slc7a14	T	C	3: 31,224,112	H448R	probably benign	Het
Smc3	G	A	19: 53,625,163		probably null	Het
Sox6	A	T	7: 115,486,628	D659E	probably damaging	Het
Stard9	GCCC	GCC	2: 120,693,715		probably null	Het
Tsr1	C	T	11: 74,900,293		probably null	Het
Ttc12	T	C	9: 49,443,122	K565E	probably damaging	Het
Ube4b	A	T	4: 149,368,311	V386E	probably benign	Het
Ush2a	T	A	1: 188,728,096		probably null	Het
Vmn1r216	T	C	13: 23,099,935	F263L	probably benign	Het
Vmn2r88	T	A	14: 51,418,149	L606*	probably null	Het
Wee2	T	A	6: 40,449,620		probably null	Het
Zfhx3	T	C	8: 108,792,527	Y94H	probably damaging	Het
Zfp385c	G	A	11: 100,632,768	P120L	probably benign	Het

Other mutations in Usp5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00481:Usp5	APN	6	124829353	missense	probably benign	0.00
IGL00905:Usp5	APN	6	124815613	missense	probably damaging	1.00
IGL01584:Usp5	APN	6	124819387	missense	probably damaging	1.00
IGL01642:Usp5	APN	6	124820453	missense	probably damaging	0.99
IGL01787:Usp5	APN	6	124824226	missense	possibly damaging	0.95
IGL02394:Usp5	APN	6	124822709	missense	probably damaging	1.00
IGL02677:Usp5	APN	6	124819426	missense	probably damaging	1.00
IGL03392:Usp5	APN	6	124826387	missense	probably damaging	1.00
BB004:Usp5	UTSW	6	124824229	missense	probably benign	0.06
BB014:Usp5	UTSW	6	124824229	missense	probably benign	0.06
R0594:Usp5	UTSW	6	124817424	missense	probably damaging	0.99
R1522:Usp5	UTSW	6	124825166	missense	probably benign
R1719:Usp5	UTSW	6	124823460	missense	possibly damaging	0.94
R2185:Usp5	UTSW	6	124817410	missense	probably damaging	0.99
R3115:Usp5	UTSW	6	124815597	missense	probably damaging	1.00
R4196:Usp5	UTSW	6	124824938	missense	possibly damaging	0.78
R4347:Usp5	UTSW	6	124821195	missense	probably damaging	1.00
R4386:Usp5	UTSW	6	124818474	critical splice donor site	probably null
R4500:Usp5	UTSW	6	124822630	missense	possibly damaging	0.71
R4501:Usp5	UTSW	6	124822630	missense	possibly damaging	0.71
R4526:Usp5	UTSW	6	124822630	missense	possibly damaging	0.71
R4527:Usp5	UTSW	6	124822630	missense	possibly damaging	0.71
R4528:Usp5	UTSW	6	124822630	missense	possibly damaging	0.71
R4684:Usp5	UTSW	6	124817956	missense	probably damaging	1.00
R4912:Usp5	UTSW	6	124822630	missense	possibly damaging	0.71
R4913:Usp5	UTSW	6	124822630	missense	possibly damaging	0.71
R4954:Usp5	UTSW	6	124822630	missense	possibly damaging	0.71
R4956:Usp5	UTSW	6	124822630	missense	possibly damaging	0.71
R4957:Usp5	UTSW	6	124822630	missense	possibly damaging	0.71
R4958:Usp5	UTSW	6	124822630	missense	possibly damaging	0.71
R5071:Usp5	UTSW	6	124826379	missense	probably benign	0.13
R6236:Usp5	UTSW	6	124818478	missense	probably benign	0.05
R6370:Usp5	UTSW	6	124820428	missense	probably benign	0.01
R7090:Usp5	UTSW	6	124829394	start codon destroyed	probably null
R7317:Usp5	UTSW	6	124826318	missense	probably damaging	0.98
R7447:Usp5	UTSW	6	124821114	missense	probably damaging	1.00
R7572:Usp5	UTSW	6	124818007	missense	probably damaging	0.99
R7598:Usp5	UTSW	6	124826379	missense	possibly damaging	0.73
R7927:Usp5	UTSW	6	124824229	missense	probably benign	0.06
R7931:Usp5	UTSW	6	124824446	intron	probably benign
R8089:Usp5	UTSW	6	124820410	critical splice donor site	probably null
R8361:Usp5	UTSW	6	124824985	missense	probably damaging	1.00
R8544:Usp5	UTSW	6	124823517	missense	probably damaging	1.00
R8679:Usp5	UTSW	6	124817431	missense	possibly damaging	0.94
R9115:Usp5	UTSW	6	124826421	missense	probably damaging	0.97
R9128:Usp5	UTSW	6	124823451	critical splice donor site	probably null
R9227:Usp5	UTSW	6	124818636	missense	probably damaging	1.00
R9651:Usp5	UTSW	6	124822538	missense	possibly damaging	0.91
X0058:Usp5	UTSW	6	124824176	missense	probably damaging	1.00
Z1177:Usp5	UTSW	6	124825148	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- CCAGGTCATCAATGTGGCTG -3'
(R):5'- TCATCCACAGATTTTGCAAACC -3'

Sequencing Primer
(F):5'- CAATGTGGCTGAAGATCCAGTCTAC -3'
(R):5'- ATCCTGCCTGGCTCCAGTG -3'

Posted On

2017-06-27