Incidental Mutation 'R6022:Jmy'
ID482057
Institutional Source Beutler Lab
Gene Symbol Jmy
Ensembl Gene ENSMUSG00000021690
Gene Namejunction-mediating and regulatory protein
Synonyms
MMRRC Submission 043256-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.140) question?
Stock #R6022 (G1)
Quality Score91.0077
Status Not validated
Chromosome13
Chromosomal Location93430101-93499808 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to T at 93453578 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000070339 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065537]
Predicted Effect probably null
Transcript: ENSMUST00000065537
SMART Domains Protein: ENSMUSP00000070339
Gene: ENSMUSG00000021690

DomainStartEndE-ValueType
Pfam:WHAMM-JMY_N 5 55 6.2e-30 PFAM
low complexity region 77 94 N/A INTRINSIC
low complexity region 117 128 N/A INTRINSIC
low complexity region 152 181 N/A INTRINSIC
low complexity region 202 217 N/A INTRINSIC
Pfam:JMY 220 574 2.2e-175 PFAM
SCOP:d1jvr__ 794 816 4e-3 SMART
WH2 916 933 2.21e-2 SMART
low complexity region 964 975 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223297
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T G 11: 9,290,759 F874C probably damaging Het
Adam9 T C 8: 25,003,305 T96A possibly damaging Het
Arhgef26 C T 3: 62,428,939 T633M probably damaging Het
Atxn2l A G 7: 126,496,435 probably null Het
AW209491 C T 13: 14,637,780 A406V probably benign Het
Brix1 C T 15: 10,476,589 R267H probably benign Het
Caskin1 T A 17: 24,496,735 F158I probably benign Het
Ces1g T A 8: 93,328,457 N204I probably damaging Het
Chd1 A G 17: 17,377,773 I41V probably benign Het
Crybg2 A T 4: 134,074,273 K915* probably null Het
Dock4 T C 12: 40,748,110 V911A probably benign Het
Dok5 A G 2: 170,879,222 Y302C probably damaging Het
Dpysl4 A T 7: 139,086,084 probably benign Het
Dsc3 A C 18: 19,966,338 V707G probably damaging Het
Endog A G 2: 30,172,909 Y187C possibly damaging Het
Fcrl5 A G 3: 87,455,763 T526A probably benign Het
Gcat T C 15: 79,042,278 V116A probably damaging Het
Gm10471 T G 5: 26,084,679 E250A probably benign Het
Herc1 A G 9: 66,483,685 D3975G probably damaging Het
Kif1b T C 4: 149,198,532 I1273V probably benign Het
Lrriq1 G T 10: 103,215,534 N452K possibly damaging Het
Lrrn3 T C 12: 41,453,430 E296G probably damaging Het
Marco G A 1: 120,488,565 L208F probably benign Het
Mme T A 3: 63,364,797 W606R probably damaging Het
Parp14 G A 16: 35,841,457 P1403S probably benign Het
Phc3 A G 3: 30,930,025 S647P probably damaging Het
Prx A G 7: 27,517,573 K500E probably damaging Het
Ptpn22 T A 3: 103,886,105 V524E probably benign Het
Ptprj A T 2: 90,471,323 I155K probably benign Het
Rad51ap2 A G 12: 11,458,522 E815G probably damaging Het
Rnf150 T C 8: 83,042,729 V381A probably benign Het
Rnf213 A G 11: 119,486,010 K5103R probably benign Het
Tecpr1 A T 5: 144,199,191 W961R possibly damaging Het
Tnn A T 1: 160,110,358 D932E probably benign Het
Tram2 G A 1: 21,079,137 probably benign Het
Trbv26 T A 6: 41,227,575 probably benign Het
Trmt11 A G 10: 30,587,501 I206T possibly damaging Het
Ttk T C 9: 83,839,322 Y87H probably damaging Het
Uri1 A T 7: 37,961,477 probably benign Het
Vmn1r173 A G 7: 23,702,835 D165G probably benign Het
Xpc A G 6: 91,499,636 S494P probably damaging Het
Zfp438 T A 18: 5,213,419 N513I probably damaging Het
Other mutations in Jmy
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00798:Jmy APN 13 93441402 missense probably benign 0.00
IGL00949:Jmy APN 13 93454002 missense probably damaging 1.00
IGL01111:Jmy APN 13 93441021 missense probably damaging 1.00
IGL01734:Jmy APN 13 93459651 missense probably damaging 1.00
IGL01926:Jmy APN 13 93459786 missense probably damaging 1.00
IGL01985:Jmy APN 13 93459636 missense possibly damaging 0.58
IGL02183:Jmy APN 13 93499242 missense possibly damaging 0.78
IGL02517:Jmy APN 13 93452808 missense probably benign 0.01
IGL02524:Jmy APN 13 93472760 missense probably damaging 1.00
IGL02697:Jmy APN 13 93459701 nonsense probably null
IGL03024:Jmy APN 13 93499199 missense probably damaging 1.00
R0242:Jmy UTSW 13 93441618 missense probably benign 0.07
R0242:Jmy UTSW 13 93441618 missense probably benign 0.07
R0623:Jmy UTSW 13 93452817 missense probably benign 0.37
R0623:Jmy UTSW 13 93452817 missense probably benign 0.37
R0722:Jmy UTSW 13 93452817 missense probably benign 0.37
R1533:Jmy UTSW 13 93441311 missense probably benign
R1667:Jmy UTSW 13 93498370 missense probably damaging 1.00
R1737:Jmy UTSW 13 93498795 missense probably damaging 0.99
R1815:Jmy UTSW 13 93454077 missense probably damaging 1.00
R2057:Jmy UTSW 13 93459703 missense probably damaging 1.00
R3522:Jmy UTSW 13 93454050 missense probably damaging 1.00
R3765:Jmy UTSW 13 93464711 missense possibly damaging 0.78
R4231:Jmy UTSW 13 93498925 missense probably benign
R4279:Jmy UTSW 13 93498882 missense probably damaging 1.00
R4279:Jmy UTSW 13 93499273 missense probably damaging 1.00
R4330:Jmy UTSW 13 93498882 missense probably damaging 1.00
R4330:Jmy UTSW 13 93499273 missense probably damaging 1.00
R4845:Jmy UTSW 13 93439738 missense possibly damaging 0.80
R5047:Jmy UTSW 13 93441572 missense possibly damaging 0.65
R5403:Jmy UTSW 13 93441396 missense probably benign 0.08
R5941:Jmy UTSW 13 93498825 missense probably benign
R5953:Jmy UTSW 13 93499116 missense possibly damaging 0.62
R6150:Jmy UTSW 13 93441133 missense probably benign 0.10
R6520:Jmy UTSW 13 93454039 missense probably benign 0.10
R7073:Jmy UTSW 13 93441333 missense probably benign 0.01
R7074:Jmy UTSW 13 93453931 missense probably benign 0.15
R7325:Jmy UTSW 13 93472743 missense probably damaging 0.99
R7575:Jmy UTSW 13 93464595 nonsense probably null
R7641:Jmy UTSW 13 93442599 missense probably damaging 1.00
R7674:Jmy UTSW 13 93442599 missense probably damaging 1.00
R7862:Jmy UTSW 13 93499195 missense possibly damaging 0.75
R7945:Jmy UTSW 13 93499195 missense possibly damaging 0.75
Z1088:Jmy UTSW 13 93441081 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTTCTTGGCTGAGACACG -3'
(R):5'- GGGCTACACATGGCGTTTGTAG -3'

Sequencing Primer
(F):5'- TGAGACACGGCCCCTTCTTG -3'
(R):5'- CCTGCTTTGTTAAAGGATTTTCATC -3'
Posted On2017-06-27