Incidental Mutation 'R6005:Gucy1a2'
ID482069
Institutional Source Beutler Lab
Gene Symbol Gucy1a2
Ensembl Gene ENSMUSG00000041624
Gene Nameguanylate cyclase 1, soluble, alpha 2
Synonyms6330407I18Rik, A230060L24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.427) question?
Stock #R6005 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location3532778-3894736 bp(+) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) T to C at 3865518 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000111398 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115733]
Predicted Effect probably null
Transcript: ENSMUST00000115733
SMART Domains Protein: ENSMUSP00000111398
Gene: ENSMUSG00000041624

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
low complexity region 38 49 N/A INTRINSIC
low complexity region 51 72 N/A INTRINSIC
Pfam:HNOB 121 268 3e-19 PFAM
PDB:4GJ4|D 316 441 1e-17 PDB
CYCc 483 674 6.58e-93 SMART
low complexity region 701 715 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.2%
  • 20x: 90.9%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Soluble guanylate cyclases are heterodimeric proteins that catalyze the conversion of GTP to 3',5'-cyclic GMP and pyrophosphate. The protein encoded by this gene is an alpha subunit of this complex and it interacts with a beta subunit to form the guanylate cyclase enzyme, which is activated by nitric oxide. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a null mutation display normal blood vessel and platelet physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810006K23Rik G T 5: 124,340,774 E153* probably null Het
4930412O13Rik T C 2: 9,882,827 probably benign Het
7530416G11Rik A T 15: 85,494,109 I111N unknown Het
Adgb C T 10: 10,395,352 R849H probably damaging Het
Ahnak T C 19: 9,015,161 V4603A possibly damaging Het
AI464131 T A 4: 41,498,895 H245L probably benign Het
Ank1 A G 8: 23,132,202 D1589G probably damaging Het
Ankrd2 A G 19: 42,040,115 D70G probably damaging Het
Arid2 T C 15: 96,370,972 S989P probably benign Het
Bbs1 A T 19: 4,903,795 Y113* probably null Het
Bfsp2 T G 9: 103,448,550 K298T probably damaging Het
Bpi G A 2: 158,262,480 V168I possibly damaging Het
Cacna2d1 T C 5: 16,361,821 S921P probably damaging Het
Clec4d A C 6: 123,267,159 T76P probably damaging Het
Coq8b C T 7: 27,257,325 Q468* probably null Het
Dennd6b T C 15: 89,188,168 E248G possibly damaging Het
Ednra A G 8: 77,674,927 S245P possibly damaging Het
Epb41l4a C T 18: 33,828,143 C446Y probably benign Het
Fam221a A G 6: 49,367,822 probably benign Het
Fam229a T C 4: 129,491,503 S76P probably benign Het
Fryl C T 5: 73,083,295 D1321N probably damaging Het
Gli2 C T 1: 118,842,064 R586H probably damaging Het
Gm13089 T A 4: 143,698,432 H147L probably benign Het
Gm94 C T 18: 43,792,797 A16T possibly damaging Het
Gorasp2 T C 2: 70,690,751 V355A probably benign Het
Grid1 C A 14: 35,323,412 T404N probably damaging Het
Gtf2i C A 5: 134,255,958 E475* probably null Het
Hs3st5 T A 10: 36,832,928 I153N probably damaging Het
Il11ra1 T C 4: 41,763,887 probably null Het
Ireb2 G A 9: 54,908,805 G887S probably damaging Het
Kdsr T C 1: 106,734,581 E248G probably benign Het
Lemd2 C G 17: 27,190,785 R464P probably damaging Het
Lrrfip1 T C 1: 91,114,611 V246A probably damaging Het
Macf1 T A 4: 123,474,275 D2231V possibly damaging Het
Map2k5 C T 9: 63,281,019 D283N probably damaging Het
Mfsd5 A G 15: 102,281,492 D433G possibly damaging Het
Mir700 C A 4: 135,412,307 probably null Het
Mroh9 A T 1: 163,075,677 F52L probably damaging Het
Mycbp2 A C 14: 103,156,723 S2691A probably benign Het
Nktr T A 9: 121,748,394 probably benign Het
Obsl1 C A 1: 75,492,215 probably null Het
Olfr1130 A T 2: 87,608,080 I231F probably damaging Het
Olfr251 T C 9: 38,378,309 S137P probably damaging Het
Olfr259 A G 2: 87,108,063 V108A probably benign Het
Olfr582 A T 7: 103,041,646 I51F probably damaging Het
Olfr855 C T 9: 19,584,885 T116I probably benign Het
Pcdhb22 T A 18: 37,519,736 I162N possibly damaging Het
Pde1c A T 6: 56,479,202 probably null Het
Pds5b A G 5: 150,769,776 probably null Het
Pkd1l1 A C 11: 8,857,113 W1568G probably damaging Het
Polr3c A T 3: 96,719,468 M258K possibly damaging Het
Prss12 A T 3: 123,482,768 I349F probably benign Het
Ptpn21 A G 12: 98,678,552 *1177Q probably null Het
Rgs22 T A 15: 36,010,567 K1125M probably benign Het
Rnf182 A G 13: 43,668,035 K21E probably damaging Het
Rpl6 G A 5: 121,205,514 probably benign Het
Samsn1 C T 16: 75,873,514 V234I probably benign Het
Scrib A G 15: 76,057,751 I1089T probably damaging Het
Sec31a T C 5: 100,363,878 T1092A probably damaging Het
Sh3bp2 G T 5: 34,562,465 R606L possibly damaging Het
Sipa1 A G 19: 5,656,201 V367A probably damaging Het
Slc25a44 C T 3: 88,412,846 E269K probably damaging Het
Slc44a4 T A 17: 34,923,454 M353K possibly damaging Het
Sorcs2 A G 5: 36,019,384 S1142P probably damaging Het
Sptbn4 A G 7: 27,418,599 F352L probably damaging Het
Synj1 A T 16: 90,969,286 N541K probably damaging Het
Tas2r113 G A 6: 132,893,696 R229K probably benign Het
Tcaf3 A T 6: 42,589,971 I728K probably benign Het
Tcea1 A G 1: 4,890,773 E167G probably benign Het
Timeless G A 10: 128,244,200 R406H probably damaging Het
Traf6 C T 2: 101,696,684 R260* probably null Het
Traj31 C T 14: 54,187,931 probably benign Het
Ttn A T 2: 76,769,563 V19089D probably damaging Het
Unc80 C T 1: 66,627,257 S1868L possibly damaging Het
Wdr38 A T 2: 39,001,321 I287F possibly damaging Het
Wnt2 G A 6: 18,030,323 probably benign Het
Wnt5b G A 6: 119,433,654 P288L probably benign Het
Xkr5 G T 8: 18,934,505 N174K probably benign Het
Zbtb6 C T 2: 37,428,965 R317Q probably damaging Het
Zcchc7 AGGGG AGGG 4: 44,931,218 probably null Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Other mutations in Gucy1a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00549:Gucy1a2 APN 9 3759418 missense probably damaging 1.00
IGL00768:Gucy1a2 APN 9 3635111 missense possibly damaging 0.65
IGL00928:Gucy1a2 APN 9 3759777 missense probably damaging 1.00
IGL01520:Gucy1a2 APN 9 3759561 missense probably damaging 0.99
IGL01566:Gucy1a2 APN 9 3634661 missense probably damaging 1.00
IGL01819:Gucy1a2 APN 9 3865409 nonsense probably null
IGL01874:Gucy1a2 APN 9 3797343 missense probably damaging 1.00
IGL02442:Gucy1a2 APN 9 3865385 missense probably damaging 1.00
IGL02608:Gucy1a2 APN 9 3635113 missense probably damaging 0.99
IGL02612:Gucy1a2 APN 9 3894556 missense possibly damaging 0.74
IGL02719:Gucy1a2 APN 9 3894719 utr 3 prime probably benign
IGL02823:Gucy1a2 APN 9 3894656 missense possibly damaging 0.79
IGL02852:Gucy1a2 APN 9 3759691 missense probably benign 0.31
IGL02892:Gucy1a2 APN 9 3634471 missense probably damaging 1.00
IGL02964:Gucy1a2 APN 9 3759542 missense probably damaging 0.96
Rico UTSW 9 3579513 splice site probably null
R0096:Gucy1a2 UTSW 9 3758928 intron probably benign
R0417:Gucy1a2 UTSW 9 3759484 missense possibly damaging 0.80
R0920:Gucy1a2 UTSW 9 3759472 missense probably damaging 1.00
R1146:Gucy1a2 UTSW 9 3759830 missense probably damaging 1.00
R1146:Gucy1a2 UTSW 9 3759830 missense probably damaging 1.00
R1384:Gucy1a2 UTSW 9 3759620 missense probably damaging 1.00
R1631:Gucy1a2 UTSW 9 3533052 missense probably damaging 1.00
R1711:Gucy1a2 UTSW 9 3759622 missense probably benign 0.04
R1730:Gucy1a2 UTSW 9 3634957 missense probably benign 0.36
R1800:Gucy1a2 UTSW 9 3582685 missense possibly damaging 0.62
R2069:Gucy1a2 UTSW 9 3582697 missense probably damaging 1.00
R2166:Gucy1a2 UTSW 9 3579513 splice site probably null
R2357:Gucy1a2 UTSW 9 3797299 missense probably damaging 0.97
R3401:Gucy1a2 UTSW 9 3635154 missense probably benign 0.00
R3953:Gucy1a2 UTSW 9 3582704 splice site probably benign
R4420:Gucy1a2 UTSW 9 3634640 missense probably damaging 1.00
R4731:Gucy1a2 UTSW 9 3759424 missense probably benign 0.02
R4732:Gucy1a2 UTSW 9 3759424 missense probably benign 0.02
R4733:Gucy1a2 UTSW 9 3759424 missense probably benign 0.02
R4931:Gucy1a2 UTSW 9 3759588 missense probably damaging 1.00
R5094:Gucy1a2 UTSW 9 3865443 missense probably damaging 1.00
R5852:Gucy1a2 UTSW 9 3865460 missense probably damaging 0.99
R7667:Gucy1a2 UTSW 9 3759580 missense probably damaging 1.00
R7841:Gucy1a2 UTSW 9 3634766 missense probably benign 0.03
R7866:Gucy1a2 UTSW 9 3532804 start codon destroyed probably null
R8525:Gucy1a2 UTSW 9 3865365 missense probably damaging 1.00
R8802:Gucy1a2 UTSW 9 3635050 missense not run
Z1176:Gucy1a2 UTSW 9 3635156 missense probably damaging 1.00
Z1177:Gucy1a2 UTSW 9 3797245 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GGCCTCTGAACAAACATGTAC -3'
(R):5'- CCTACATAACTTTCAGTCACCTCAG -3'

Sequencing Primer
(F):5'- GAGTACGAATGCCACGAT -3'
(R):5'- AGATTTTCTTACCCACTTTCTTGAAG -3'
Posted On2017-06-27