Incidental Mutation 'R6009:Il17f'
ID482072
Institutional Source Beutler Lab
Gene Symbol Il17f
Ensembl Gene ENSMUSG00000041872
Gene Nameinterleukin 17F
Synonyms
MMRRC Submission 044186-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R6009 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location20777146-20790617 bp(-) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) C to T at 20779286 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140122 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039046] [ENSMUST00000189301] [ENSMUST00000189301]
Predicted Effect probably null
Transcript: ENSMUST00000039046
SMART Domains Protein: ENSMUSP00000046960
Gene: ENSMUSG00000041872

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:IL17 75 153 3.8e-32 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000189301
SMART Domains Protein: ENSMUSP00000140122
Gene: ENSMUSG00000041872

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:IL17 74 154 5.4e-33 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000189301
SMART Domains Protein: ENSMUSP00000140122
Gene: ENSMUSG00000041872

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:IL17 74 154 5.4e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191111
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.3%
  • 20x: 91.5%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytokine that shares sequence similarity with IL17. This cytokine is expressed by activated T cells, and has been shown to stimulate the production of several other cytokines, including IL6, IL8, and CSF2/GM_CSF. This cytokine is also found to inhibit the angiogenesis of endothelial cells and induce endothelial cells to produce IL2, TGFB1/TGFB, and monocyte chemoattractant protein-1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for one null allele exhibit increased susceptibility to oral bacterial infection while mice homozygous for another null allele exhibit decreased susceptibility to experimental models of colitis and CNS inflammation but have enhanced inflammatory responses to a chronic asthma model. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr8 A G 14: 29,978,497 probably benign Het
Afap1 T C 5: 35,997,560 S683P probably damaging Het
Chid1 T A 7: 141,529,580 D131V probably damaging Het
Clstn2 C T 9: 97,456,526 R860Q probably benign Het
Crlf1 A C 8: 70,503,479 K403T probably damaging Het
Ctdspl2 T G 2: 121,988,838 N201K probably benign Het
Cyb561a3 G A 19: 10,586,808 V171I possibly damaging Het
Dazap1 T C 10: 80,285,304 probably benign Het
Dbf4 G T 5: 8,403,718 Q235K probably damaging Het
Dgka C T 10: 128,723,679 G471D probably damaging Het
Fam13b A T 18: 34,497,405 F100Y possibly damaging Het
Flii A T 11: 60,720,757 L376* probably null Het
Fnip1 G T 11: 54,502,271 G487V probably damaging Het
Gm7247 C T 14: 51,364,348 S26F probably benign Het
Golgb1 G T 16: 36,914,959 A1523S probably damaging Het
Gstm4 A G 3: 108,043,343 V114A possibly damaging Het
Gtf3c1 A G 7: 125,647,430 F1569S possibly damaging Het
Gtf3c5 A T 2: 28,571,165 D312E probably benign Het
Gtpbp1 G A 15: 79,712,096 V149M probably damaging Het
Hoxa7 C T 6: 52,217,387 V7M probably damaging Het
Ints9 T C 14: 65,008,082 V263A probably benign Het
Kansl1l C T 1: 66,735,600 C689Y probably benign Het
Kctd7 G A 5: 130,145,198 G39E probably damaging Het
Krt82 T A 15: 101,545,105 D282V probably benign Het
Lemd1 G T 1: 132,228,252 E11* probably null Het
Maml2 A G 9: 13,620,998 T503A probably benign Het
Mief2 A G 11: 60,731,659 T352A probably benign Het
Msantd1 C A 5: 34,917,705 T37K probably benign Het
Mtus2 A G 5: 148,306,652 E94G probably damaging Het
Naaa A T 5: 92,259,581 L353Q probably benign Het
Nek5 T C 8: 22,120,822 E55G probably benign Het
Npat T C 9: 53,563,449 M847T probably damaging Het
Nus1 G A 10: 52,433,443 V268I probably benign Het
Olfr550 A G 7: 102,578,594 N33S possibly damaging Het
Parn C T 16: 13,667,564 D23N probably damaging Het
Pdgfa T C 5: 138,979,199 E176G probably damaging Het
Plcl1 T A 1: 55,696,246 F249I probably damaging Het
Plscr5 C T 9: 92,204,435 Q153* probably null Het
Polr2b T C 5: 77,320,252 I133T probably benign Het
Polr3c A G 3: 96,713,614 S463P probably damaging Het
Pprc1 A T 19: 46,071,732 I1530L probably damaging Het
Prex1 C T 2: 166,581,984 S996N probably damaging Het
Rnf169 C A 7: 99,927,123 R291S possibly damaging Het
Setd5 A G 6: 113,110,519 K127R probably damaging Het
Slc25a26 G T 6: 94,510,826 V89L probably benign Het
Slc4a10 A G 2: 62,046,690 T16A probably benign Het
Smchd1 A T 17: 71,440,956 H430Q probably damaging Het
Ttll7 A T 3: 146,934,535 D503V probably damaging Het
Vav2 A T 2: 27,271,900 probably null Het
Zfp345 A T 2: 150,472,517 C367S probably damaging Het
Zfp651 T C 9: 121,762,871 S86P possibly damaging Het
Zfp964 T A 8: 69,663,456 H235Q possibly damaging Het
Other mutations in Il17f
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0800:Il17f UTSW 1 20777953 nonsense probably null
R2224:Il17f UTSW 1 20779375 missense probably damaging 0.97
R4074:Il17f UTSW 1 20777763 unclassified probably benign
R4594:Il17f UTSW 1 20777802 missense probably damaging 1.00
R5386:Il17f UTSW 1 20777957 missense probably benign 0.00
R6416:Il17f UTSW 1 20777907 missense probably benign 0.00
R6751:Il17f UTSW 1 20779489 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGTGAATGTGAGTCCTGAATACTC -3'
(R):5'- TGCCATTCTGAGGGAGGTAG -3'

Sequencing Primer
(F):5'- TCAAGATAGAATTTCACCATGTAGC -3'
(R):5'- CATTCTGAGGGAGGTAGCAGCTC -3'
Posted On2017-06-27