Incidental Mutation 'R6009:Vav2'
ID482073
Institutional Source Beutler Lab
Gene Symbol Vav2
Ensembl Gene ENSMUSG00000009621
Gene Namevav 2 oncogene
Synonyms2810040F13Rik
MMRRC Submission 044186-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.466) question?
Stock #R6009 (G1)
Quality Score110.008
Status Validated
Chromosome2
Chromosomal Location27262104-27427033 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 27271900 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000062782 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056176] [ENSMUST00000056176] [ENSMUST00000185188] [ENSMUST00000185188]
Predicted Effect probably null
Transcript: ENSMUST00000056176
SMART Domains Protein: ENSMUSP00000062782
Gene: ENSMUSG00000009621

DomainStartEndE-ValueType
CH 3 115 1.87e-24 SMART
low complexity region 165 176 N/A INTRINSIC
RhoGEF 197 370 2.41e-57 SMART
PH 401 504 2.05e-10 SMART
C1 514 562 1.43e-11 SMART
SH3 579 641 1.26e-13 SMART
SH2 661 743 3.37e-25 SMART
low complexity region 759 777 N/A INTRINSIC
SH3 809 866 3.27e-21 SMART
Predicted Effect probably null
Transcript: ENSMUST00000056176
SMART Domains Protein: ENSMUSP00000062782
Gene: ENSMUSG00000009621

DomainStartEndE-ValueType
CH 3 115 1.87e-24 SMART
low complexity region 165 176 N/A INTRINSIC
RhoGEF 197 370 2.41e-57 SMART
PH 401 504 2.05e-10 SMART
C1 514 562 1.43e-11 SMART
SH3 579 641 1.26e-13 SMART
SH2 661 743 3.37e-25 SMART
low complexity region 759 777 N/A INTRINSIC
SH3 809 866 3.27e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135584
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146843
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148067
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149758
Predicted Effect probably benign
Transcript: ENSMUST00000185188
SMART Domains Protein: ENSMUSP00000138964
Gene: ENSMUSG00000009621

DomainStartEndE-ValueType
CH 3 129 3.71e-2 SMART
RhoGEF 163 336 2.41e-57 SMART
PH 367 475 1.78e-10 SMART
C1 485 533 1.43e-11 SMART
SH3 550 612 1.26e-13 SMART
SH2 632 714 1.26e-15 SMART
low complexity region 771 789 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000185188
SMART Domains Protein: ENSMUSP00000138964
Gene: ENSMUSG00000009621

DomainStartEndE-ValueType
CH 3 129 3.71e-2 SMART
RhoGEF 163 336 2.41e-57 SMART
PH 367 475 1.78e-10 SMART
C1 485 533 1.43e-11 SMART
SH3 550 612 1.26e-13 SMART
SH2 632 714 1.26e-15 SMART
low complexity region 771 789 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.3%
  • 20x: 91.5%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: This gene encodes a member of the Vav family of Rho guanine nucleotide exchange factors. Vav family proteins are involved in the development and activation of lymphocytes, and the encoded protein may also be involved in angiogenesis. Disruption of this gene in mice is associated with heart, artery, and kidney defects, as well as tachycardia and hypertension. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous null mutants have defects in humoral immune response to type II thymus-independent antigens, in primary response to thymus-dependent antigens and inability to switch immunoglobulin class, form germinal centers and generate secondary responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr8 A G 14: 29,978,497 probably benign Het
Afap1 T C 5: 35,997,560 S683P probably damaging Het
Chid1 T A 7: 141,529,580 D131V probably damaging Het
Clstn2 C T 9: 97,456,526 R860Q probably benign Het
Crlf1 A C 8: 70,503,479 K403T probably damaging Het
Ctdspl2 T G 2: 121,988,838 N201K probably benign Het
Cyb561a3 G A 19: 10,586,808 V171I possibly damaging Het
Dazap1 T C 10: 80,285,304 probably benign Het
Dbf4 G T 5: 8,403,718 Q235K probably damaging Het
Dgka C T 10: 128,723,679 G471D probably damaging Het
Fam13b A T 18: 34,497,405 F100Y possibly damaging Het
Flii A T 11: 60,720,757 L376* probably null Het
Fnip1 G T 11: 54,502,271 G487V probably damaging Het
Gm7247 C T 14: 51,364,348 S26F probably benign Het
Golgb1 G T 16: 36,914,959 A1523S probably damaging Het
Gstm4 A G 3: 108,043,343 V114A possibly damaging Het
Gtf3c1 A G 7: 125,647,430 F1569S possibly damaging Het
Gtf3c5 A T 2: 28,571,165 D312E probably benign Het
Gtpbp1 G A 15: 79,712,096 V149M probably damaging Het
Hoxa7 C T 6: 52,217,387 V7M probably damaging Het
Il17f C T 1: 20,779,286 probably null Het
Ints9 T C 14: 65,008,082 V263A probably benign Het
Kansl1l C T 1: 66,735,600 C689Y probably benign Het
Kctd7 G A 5: 130,145,198 G39E probably damaging Het
Krt82 T A 15: 101,545,105 D282V probably benign Het
Lemd1 G T 1: 132,228,252 E11* probably null Het
Maml2 A G 9: 13,620,998 T503A probably benign Het
Mief2 A G 11: 60,731,659 T352A probably benign Het
Msantd1 C A 5: 34,917,705 T37K probably benign Het
Mtus2 A G 5: 148,306,652 E94G probably damaging Het
Naaa A T 5: 92,259,581 L353Q probably benign Het
Nek5 T C 8: 22,120,822 E55G probably benign Het
Npat T C 9: 53,563,449 M847T probably damaging Het
Nus1 G A 10: 52,433,443 V268I probably benign Het
Olfr550 A G 7: 102,578,594 N33S possibly damaging Het
Parn C T 16: 13,667,564 D23N probably damaging Het
Pdgfa T C 5: 138,979,199 E176G probably damaging Het
Plcl1 T A 1: 55,696,246 F249I probably damaging Het
Plscr5 C T 9: 92,204,435 Q153* probably null Het
Polr2b T C 5: 77,320,252 I133T probably benign Het
Polr3c A G 3: 96,713,614 S463P probably damaging Het
Pprc1 A T 19: 46,071,732 I1530L probably damaging Het
Prex1 C T 2: 166,581,984 S996N probably damaging Het
Rnf169 C A 7: 99,927,123 R291S possibly damaging Het
Setd5 A G 6: 113,110,519 K127R probably damaging Het
Slc25a26 G T 6: 94,510,826 V89L probably benign Het
Slc4a10 A G 2: 62,046,690 T16A probably benign Het
Smchd1 A T 17: 71,440,956 H430Q probably damaging Het
Ttll7 A T 3: 146,934,535 D503V probably damaging Het
Zfp345 A T 2: 150,472,517 C367S probably damaging Het
Zfp651 T C 9: 121,762,871 S86P possibly damaging Het
Zfp964 T A 8: 69,663,456 H235Q possibly damaging Het
Other mutations in Vav2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Vav2 APN 2 27277238 missense probably benign 0.35
IGL02394:Vav2 APN 2 27297659 splice site probably benign
IGL03088:Vav2 APN 2 27267250 missense possibly damaging 0.74
IGL03256:Vav2 APN 2 27271900 splice site probably null
IGL03295:Vav2 APN 2 27275029 missense possibly damaging 0.90
R0097:Vav2 UTSW 2 27299362 splice site probably benign
R0097:Vav2 UTSW 2 27299362 splice site probably benign
R0140:Vav2 UTSW 2 27273676 splice site probably benign
R0331:Vav2 UTSW 2 27296175 missense probably benign 0.09
R0619:Vav2 UTSW 2 27296121 critical splice donor site probably null
R1191:Vav2 UTSW 2 27292780 splice site probably null
R1723:Vav2 UTSW 2 27318964 missense possibly damaging 0.94
R2107:Vav2 UTSW 2 27267303 missense probably damaging 1.00
R2131:Vav2 UTSW 2 27299396 missense possibly damaging 0.71
R2164:Vav2 UTSW 2 27273706 missense probably damaging 0.96
R2268:Vav2 UTSW 2 27292655 splice site probably null
R2927:Vav2 UTSW 2 27426391 missense probably damaging 1.00
R3802:Vav2 UTSW 2 27267223 splice site probably benign
R4050:Vav2 UTSW 2 27288679 missense probably benign 0.01
R4050:Vav2 UTSW 2 27291403 missense probably damaging 1.00
R4626:Vav2 UTSW 2 27270160 missense possibly damaging 0.62
R4895:Vav2 UTSW 2 27318961 missense probably damaging 0.99
R5441:Vav2 UTSW 2 27270110 intron probably benign
R6501:Vav2 UTSW 2 27296219 missense probably damaging 1.00
R6564:Vav2 UTSW 2 27279185 splice site probably null
R7206:Vav2 UTSW 2 27336719 missense probably benign 0.17
R7267:Vav2 UTSW 2 27283322 missense probably damaging 0.99
R7541:Vav2 UTSW 2 27275002 missense probably damaging 0.99
R7691:Vav2 UTSW 2 27297738 critical splice acceptor site probably null
R7786:Vav2 UTSW 2 27386601 missense probably damaging 1.00
R7822:Vav2 UTSW 2 27282287 critical splice donor site probably null
X0064:Vav2 UTSW 2 27282351 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTCAGTAGCAGGCTAAAGAG -3'
(R):5'- GTTCTGGTCCCCACATTGTG -3'

Sequencing Primer
(F):5'- CTAAAGAGGGACACTTATGGGCCC -3'
(R):5'- TGTGTATCAGGACATGGCCACATAC -3'
Posted On2017-06-27