Incidental Mutation 'R6034:Tc2n'
ID482109
Institutional Source Beutler Lab
Gene Symbol Tc2n
Ensembl Gene ENSMUSG00000021187
Gene Nametandem C2 domains, nuclear
Synonyms4933406D09Rik, Tac2-N, Mtac2d1
MMRRC Submission 044206-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R6034 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location101645443-101718523 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 101651201 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110047] [ENSMUST00000160715] [ENSMUST00000160715] [ENSMUST00000160830] [ENSMUST00000162735]
Predicted Effect probably benign
Transcript: ENSMUST00000110047
SMART Domains Protein: ENSMUSP00000105674
Gene: ENSMUSG00000021187

DomainStartEndE-ValueType
low complexity region 162 173 N/A INTRINSIC
low complexity region 190 210 N/A INTRINSIC
C2 238 339 5.56e0 SMART
C2 366 472 1.02e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000160715
SMART Domains Protein: ENSMUSP00000125099
Gene: ENSMUSG00000021187

DomainStartEndE-ValueType
low complexity region 162 173 N/A INTRINSIC
low complexity region 190 210 N/A INTRINSIC
Blast:C2 238 287 1e-24 BLAST
C2 302 408 1.02e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000160715
SMART Domains Protein: ENSMUSP00000125099
Gene: ENSMUSG00000021187

DomainStartEndE-ValueType
low complexity region 162 173 N/A INTRINSIC
low complexity region 190 210 N/A INTRINSIC
Blast:C2 238 287 1e-24 BLAST
C2 302 408 1.02e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000160830
SMART Domains Protein: ENSMUSP00000124287
Gene: ENSMUSG00000021187

DomainStartEndE-ValueType
low complexity region 162 173 N/A INTRINSIC
low complexity region 190 210 N/A INTRINSIC
C2 238 339 5.56e0 SMART
C2 366 472 1.02e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000162735
SMART Domains Protein: ENSMUSP00000125288
Gene: ENSMUSG00000021187

DomainStartEndE-ValueType
low complexity region 162 173 N/A INTRINSIC
low complexity region 190 210 N/A INTRINSIC
C2 238 339 5.56e0 SMART
C2 366 472 1.02e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162999
Meta Mutation Damage Score 0.608 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 96.4%
  • 20x: 87.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef4 G T 1: 34,721,903 G80V unknown Het
Ash1l T C 3: 88,985,019 Y1402H probably damaging Het
Atad2 A T 15: 58,108,563 L306Q probably damaging Het
Atp2b4 T A 1: 133,731,907 probably null Het
Atp6v1c2 C A 12: 17,307,500 G95V possibly damaging Het
Birc6 T A 17: 74,615,283 V2192E probably damaging Het
Catsperb A G 12: 101,575,832 E597G probably benign Het
Ccdc129 T A 6: 55,967,681 D462E possibly damaging Het
Ccdc40 A G 11: 119,243,072 M556V possibly damaging Het
Ccin G A 4: 43,985,354 R587K probably benign Het
Cdipt T G 7: 126,978,325 V81G probably damaging Het
Cfh T C 1: 140,163,131 K40E probably damaging Het
Col4a3bp A C 13: 96,609,800 I236L probably benign Het
Cps1 T A 1: 67,157,713 probably null Het
Dnah7c A T 1: 46,457,258 D101V probably benign Het
Fastkd3 T A 13: 68,583,610 W17R probably damaging Het
H2-Ob T C 17: 34,241,218 V30A probably damaging Het
Hist1h1e A G 13: 23,622,313 L62P probably damaging Het
Hmgxb3 T A 18: 61,132,522 H1128L probably damaging Het
Hspbp1 A T 7: 4,677,712 I255N probably damaging Het
Imp4 A G 1: 34,443,456 D91G probably damaging Het
Kcnip4 G T 5: 48,390,941 R241S possibly damaging Het
Lilra5 T C 7: 4,242,134 L259P probably benign Het
Lipf T C 19: 33,964,889 I73T probably benign Het
Lsm7 T C 10: 80,852,908 probably null Het
Luzp2 T A 7: 55,167,224 L141M probably damaging Het
Malrd1 T A 2: 15,845,326 V1252E possibly damaging Het
Map10 T C 8: 125,672,466 L866P probably damaging Het
Mink1 AAGCAGCAGCAGCAGCAGCAGCAG AAGCAGCAGCAGCAGCAGCAG 11: 70,607,040 probably benign Het
Mpp2 T C 11: 102,061,634 I355V possibly damaging Het
Mtrf1l T A 10: 5,823,834 probably benign Het
Myo5c A T 9: 75,255,905 T339S probably benign Het
Naa15 A G 3: 51,442,821 D163G probably damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1303 T A 2: 111,814,357 Y123F probably damaging Het
Oosp2 A G 19: 11,651,515 F74S probably damaging Het
Pard3 C G 8: 127,064,327 probably benign Het
Pcdha1 T A 18: 36,930,598 I105N probably damaging Het
Pcdhgb8 A G 18: 37,762,548 T224A possibly damaging Het
Phf12 A G 11: 78,018,069 N325S probably benign Het
Prom1 T A 5: 44,044,408 probably null Het
Raet1e A G 10: 22,182,091 *252W probably null Het
Sap130 T C 18: 31,689,406 V655A possibly damaging Het
Sec16b A T 1: 157,552,939 K360I probably damaging Het
Sec23ip C T 7: 128,750,203 T101I possibly damaging Het
Selenoo A G 15: 89,099,343 K529R probably benign Het
Slc22a15 A G 3: 101,862,919 F451L possibly damaging Het
St6gal2 T A 17: 55,482,981 S339T probably benign Het
Stard13 A T 5: 151,095,500 probably null Het
Synm A G 7: 67,734,905 V561A probably damaging Het
Ugt2b36 T A 5: 87,081,518 D236V probably damaging Het
Vmn1r65 A G 7: 6,008,869 L122P probably damaging Het
Zc3h14 T C 12: 98,771,373 S40P probably benign Het
Zc3hav1l C A 6: 38,295,280 G185C probably damaging Het
Zfp563 G A 17: 33,104,961 A177T probably damaging Het
Other mutations in Tc2n
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01656:Tc2n APN 12 101649089 utr 3 prime probably benign
IGL02129:Tc2n APN 12 101689789 missense probably damaging 0.99
IGL02630:Tc2n APN 12 101693145 missense probably damaging 0.99
R0517:Tc2n UTSW 12 101649195 missense probably damaging 0.98
R0980:Tc2n UTSW 12 101678576 nonsense probably null
R1676:Tc2n UTSW 12 101688992 missense probably damaging 1.00
R2187:Tc2n UTSW 12 101706544 missense probably damaging 1.00
R3771:Tc2n UTSW 12 101694574 missense possibly damaging 0.68
R4082:Tc2n UTSW 12 101651155 missense possibly damaging 0.85
R4180:Tc2n UTSW 12 101665695 missense probably damaging 1.00
R4707:Tc2n UTSW 12 101694573 missense probably benign 0.16
R4793:Tc2n UTSW 12 101651117 missense possibly damaging 0.86
R4917:Tc2n UTSW 12 101665695 missense probably damaging 1.00
R5214:Tc2n UTSW 12 101693202 nonsense probably null
R5870:Tc2n UTSW 12 101652852 missense probably damaging 1.00
R6034:Tc2n UTSW 12 101651201 splice site probably null
R6128:Tc2n UTSW 12 101709489 start codon destroyed probably null 0.99
R7200:Tc2n UTSW 12 101689055 missense probably damaging 1.00
R7469:Tc2n UTSW 12 101665675 missense probably damaging 1.00
R7471:Tc2n UTSW 12 101706457 missense probably damaging 0.99
Predicted Primers
Posted On2017-06-27