Incidental Mutation 'R5998:Atp8b4'
ID482111
Institutional Source Beutler Lab
Gene Symbol Atp8b4
Ensembl Gene ENSMUSG00000060131
Gene NameATPase, class I, type 8B, member 4
SynonymsIm
MMRRC Submission 044177-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R5998 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location126320973-126500674 bp(-) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) A to G at 126433867 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000118651 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040128] [ENSMUST00000040128] [ENSMUST00000040149] [ENSMUST00000129187] [ENSMUST00000129187] [ENSMUST00000147517]
Predicted Effect probably null
Transcript: ENSMUST00000040128
SMART Domains Protein: ENSMUSP00000046444
Gene: ENSMUSG00000060131

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 15 81 3.4e-30 PFAM
Pfam:E1-E2_ATPase 81 352 5.1e-8 PFAM
Pfam:HAD 390 826 1.1e-18 PFAM
Pfam:Cation_ATPase 474 573 5.5e-10 PFAM
Pfam:PhoLip_ATPase_C 843 1097 1.6e-83 PFAM
low complexity region 1113 1130 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000040128
SMART Domains Protein: ENSMUSP00000046444
Gene: ENSMUSG00000060131

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 15 81 3.4e-30 PFAM
Pfam:E1-E2_ATPase 81 352 5.1e-8 PFAM
Pfam:HAD 390 826 1.1e-18 PFAM
Pfam:Cation_ATPase 474 573 5.5e-10 PFAM
Pfam:PhoLip_ATPase_C 843 1097 1.6e-83 PFAM
low complexity region 1113 1130 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000040149
SMART Domains Protein: ENSMUSP00000047302
Gene: ENSMUSG00000060131

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 15 81 3.4e-30 PFAM
Pfam:E1-E2_ATPase 81 352 5.1e-8 PFAM
Pfam:HAD 390 826 1.1e-18 PFAM
Pfam:Cation_ATPase 474 573 5.5e-10 PFAM
Pfam:PhoLip_ATPase_C 843 1097 1.6e-83 PFAM
low complexity region 1113 1130 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000129187
SMART Domains Protein: ENSMUSP00000118651
Gene: ENSMUSG00000060131

DomainStartEndE-ValueType
low complexity region 6 17 N/A INTRINSIC
Blast:CUB 32 67 2e-7 BLAST
Pfam:E1-E2_ATPase 84 355 1.6e-17 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000129187
SMART Domains Protein: ENSMUSP00000118651
Gene: ENSMUSG00000060131

DomainStartEndE-ValueType
low complexity region 6 17 N/A INTRINSIC
Blast:CUB 32 67 2e-7 BLAST
Pfam:E1-E2_ATPase 84 355 1.6e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134977
Predicted Effect probably benign
Transcript: ENSMUST00000147517
SMART Domains Protein: ENSMUSP00000114252
Gene: ENSMUSG00000060131

DomainStartEndE-ValueType
low complexity region 6 17 N/A INTRINSIC
Blast:CUB 32 67 2e-7 BLAST
Pfam:E1-E2_ATPase 84 355 1.9e-17 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.3%
  • 20x: 91.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cation transport ATPase (P-type) family and type IV subfamily. The encoded protein is involved in phospholipid transport in the cell membrane. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 G A 11: 9,567,708 V4437I probably damaging Het
Acot12 T C 13: 91,757,534 I71T possibly damaging Het
Adcy10 A G 1: 165,541,649 I630V probably benign Het
Adcy3 T A 12: 4,198,348 V470E probably damaging Het
Adcy6 C A 15: 98,594,354 E1008* probably null Het
Adgrb3 A T 1: 25,431,501 probably null Het
Ahrr T A 13: 74,213,836 S515C probably damaging Het
Ankrd52 T C 10: 128,383,123 I416T probably damaging Het
Arhgap45 T C 10: 80,030,950 S1096P probably damaging Het
Bcl6b A C 11: 70,228,183 I200M probably damaging Het
Btbd19 T A 4: 117,120,999 E234V probably benign Het
Csmd1 G A 8: 15,910,443 T3324I probably damaging Het
Cyp2a5 G A 7: 26,837,153 V186I probably benign Het
Glb1l2 G A 9: 26,766,003 T533I possibly damaging Het
Gm10471 T C 5: 26,084,706 D241G probably damaging Het
Gm8994 T C 6: 136,328,624 F28L probably benign Het
Helz G T 11: 107,685,534 E1851* probably null Het
Igkv15-103 T A 6: 68,437,505 F13Y unknown Het
Kcnq2 T C 2: 181,087,008 H548R probably damaging Het
Mcm3ap T C 10: 76,481,142 probably null Het
Micall2 T C 5: 139,706,911 probably null Het
Mill2 A G 7: 18,840,064 R25G probably benign Het
Mtcl1 G A 17: 66,368,280 H1041Y probably damaging Het
Olfr180 T C 16: 58,916,630 T4A probably benign Het
Olfr926 G A 9: 38,877,869 R231H probably damaging Het
Pigt A G 2: 164,507,454 E559G possibly damaging Het
Pkdrej A G 15: 85,815,453 V2094A probably benign Het
Ppp1r32 A T 19: 10,481,352 W105R possibly damaging Het
Prkdc T A 16: 15,783,157 L2894Q probably damaging Het
Tmem63b A G 17: 45,670,000 V256A possibly damaging Het
Zfp516 T C 18: 82,956,514 L279P probably damaging Het
Zfp780b T A 7: 27,964,622 K169N probably benign Het
Other mutations in Atp8b4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00547:Atp8b4 APN 2 126358897 missense probably damaging 1.00
IGL00841:Atp8b4 APN 2 126383769 missense probably damaging 0.97
IGL00917:Atp8b4 APN 2 126374533 missense probably benign 0.00
IGL01013:Atp8b4 APN 2 126323087 missense probably benign 0.25
IGL01374:Atp8b4 APN 2 126383657 splice site probably benign
IGL01898:Atp8b4 APN 2 126389361 missense probably benign 0.00
IGL01927:Atp8b4 APN 2 126322976 missense probably damaging 0.99
IGL01971:Atp8b4 APN 2 126462616 missense probably benign 0.05
R0320:Atp8b4 UTSW 2 126459694 missense possibly damaging 0.55
R0441:Atp8b4 UTSW 2 126378706 splice site probably benign
R0526:Atp8b4 UTSW 2 126427363 missense probably damaging 1.00
R0765:Atp8b4 UTSW 2 126372150 splice site probably null
R0964:Atp8b4 UTSW 2 126337493 missense probably damaging 1.00
R1386:Atp8b4 UTSW 2 126378744 missense probably benign 0.00
R1401:Atp8b4 UTSW 2 126323093 critical splice acceptor site probably null
R1568:Atp8b4 UTSW 2 126325394 missense probably benign
R1792:Atp8b4 UTSW 2 126325294 missense probably benign
R1830:Atp8b4 UTSW 2 126403381 missense probably benign 0.03
R1839:Atp8b4 UTSW 2 126361782 missense possibly damaging 0.92
R1984:Atp8b4 UTSW 2 126323008 missense probably damaging 1.00
R2143:Atp8b4 UTSW 2 126374510 missense probably damaging 1.00
R2186:Atp8b4 UTSW 2 126358860 missense probably damaging 1.00
R2212:Atp8b4 UTSW 2 126375757 missense probably damaging 1.00
R2473:Atp8b4 UTSW 2 126358894 missense possibly damaging 0.67
R3412:Atp8b4 UTSW 2 126375757 missense probably damaging 1.00
R3414:Atp8b4 UTSW 2 126375757 missense probably damaging 1.00
R4519:Atp8b4 UTSW 2 126414459 splice site probably null
R4543:Atp8b4 UTSW 2 126358066 missense probably damaging 0.97
R4701:Atp8b4 UTSW 2 126414293 missense probably damaging 1.00
R4818:Atp8b4 UTSW 2 126322816 missense probably benign 0.01
R4895:Atp8b4 UTSW 2 126414369 missense probably benign 0.23
R5213:Atp8b4 UTSW 2 126389409 splice site probably null
R5239:Atp8b4 UTSW 2 126392861 splice site probably null
R5241:Atp8b4 UTSW 2 126383726 missense probably benign
R5654:Atp8b4 UTSW 2 126375805 missense probably damaging 1.00
R5725:Atp8b4 UTSW 2 126433936 missense probably benign
R5771:Atp8b4 UTSW 2 126378744 missense probably benign 0.11
R5949:Atp8b4 UTSW 2 126405322 missense probably benign 0.02
R5993:Atp8b4 UTSW 2 126403234 missense probably benign
R6550:Atp8b4 UTSW 2 126424193 missense probably damaging 1.00
R6575:Atp8b4 UTSW 2 126414364 missense probably damaging 1.00
R6892:Atp8b4 UTSW 2 126343002 missense possibly damaging 0.94
R6915:Atp8b4 UTSW 2 126358914 nonsense probably null
R7045:Atp8b4 UTSW 2 126372195 missense probably benign 0.00
R7206:Atp8b4 UTSW 2 126458292 missense probably damaging 0.99
R7349:Atp8b4 UTSW 2 126325345 missense probably benign 0.00
R7395:Atp8b4 UTSW 2 126375694 missense possibly damaging 0.76
R7429:Atp8b4 UTSW 2 126403371 missense possibly damaging 0.47
R7430:Atp8b4 UTSW 2 126403371 missense possibly damaging 0.47
R7548:Atp8b4 UTSW 2 126389342 missense probably benign
R7724:Atp8b4 UTSW 2 126322893 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- AGTCACTGTGTCACCAAAAGTCAC -3'
(R):5'- ACACCCACACTCTTTGTTGG -3'

Sequencing Primer
(F):5'- AATGGTGATCCCTCCTTG -3'
(R):5'- CACACTCTTTGTTGGTTGTGAATTC -3'
Posted On2017-06-27