Mutagenetix > Incidental Mutations

Incidental Mutation 'R5999:Mroh2b'

482112

Institutional Source

Beutler Lab

Gene Symbol

Mroh2b

Ensembl Gene

ENSMUSG00000022155

Gene Name

maestro heat-like repeat family member 2B

Synonyms

4930455B06Rik, Heatr7b2

MMRRC Submission

044178-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.100) question?

Stock #

R5999 (G1)

Quality Score

182.009

Status

Validated

Chromosome

Chromosomal Location

4898737-4962205 bp(+) (GRCm38)

Type of Mutation

splice site (32 bp from exon)

DNA Base Change (assembly)

T to A at 4912884 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000036148 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045736]

Predicted Effect

probably null
Transcript: ENSMUST00000045736

SMART Domains

Protein: ENSMUSP00000036148
Gene: ENSMUSG00000022155

Domain	Start	End	E-Value	Type
low complexity region	124	135	N/A	INTRINSIC
low complexity region	824	842	N/A	INTRINSIC
SCOP:d1gw5a_	937	1443	7e-15	SMART

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.9%
3x: 99.4%
10x: 97.2%
20x: 90.9%

Validation Efficiency

98% (55/56)

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610507B11Rik	T	C	11: 78,285,468	F1799L	probably damaging	Het
Acot5	A	G	12: 84,075,554	D304G	probably benign	Het
Acyp2	C	T	11: 30,506,354	E98K	possibly damaging	Het
Aes	T	C	10: 81,561,264	S25P	probably damaging	Het
Akap9	A	G	5: 4,043,925	N2149S	probably damaging	Het
Akp3	T	A	1: 87,127,541	Y437N	probably damaging	Het
Anks1b	C	T	10: 90,359,048	T530I	probably damaging	Het
Bnc2	C	T	4: 84,555,900	R3H	probably benign	Het
Cald1	A	T	6: 34,746,338		probably benign	Het
Capn9	A	G	8: 124,589,078	T87A	probably damaging	Het
Ccdc88c	A	G	12: 100,968,354	L175P	probably damaging	Het
Cd226	T	C	18: 89,207,219	V80A	probably damaging	Het
Cd44	A	T	2: 102,845,397	N310K	probably benign	Het
Cenpc1	T	A	5: 86,012,263	K905N	probably damaging	Het
Cept1	A	T	3: 106,533,443	D133E	probably damaging	Het
Cltc	T	C	11: 86,704,129	H1381R	possibly damaging	Het
Col4a4	T	A	1: 82,492,619	T730S	unknown	Het
Col6a4	A	T	9: 106,067,921	M998K	probably benign	Het
Cpne6	T	C	14: 55,513,059	V119A	probably benign	Het
Ddx54	G	T	5: 120,623,580	A474S	probably benign	Het
Dmbx1	G	T	4: 115,918,176	N302K	probably damaging	Het
Dnah8	A	G	17: 30,663,305	E617G	probably benign	Het
Ei24	A	G	9: 36,793,307	V10A	probably benign	Het
Elp3	A	G	14: 65,531,540	V543A	probably benign	Het
Frmd3	T	C	4: 74,170,691	I375T	possibly damaging	Het
Gm6408	A	G	5: 146,484,257	D232G	possibly damaging	Het
Inmt	A	T	6: 55,174,948	Y12*	probably null	Het
Inpp5k	G	T	11: 75,633,100	A44S	probably damaging	Het
Kalrn	T	A	16: 34,357,343	T169S	probably damaging	Het
Kif28	A	T	1: 179,695,790	F992I	probably damaging	Het
Kmt2c	A	T	5: 25,284,205	Y1199N	probably damaging	Het
Large2	C	T	2: 92,366,058	E475K	probably benign	Het
Mrpl42	T	C	10: 95,500,479		probably benign	Het
Muc5b	A	T	7: 141,857,379	H1354L	unknown	Het
Myof	C	A	19: 37,939,856	E1095*	probably null	Het
Ncor2	A	G	5: 125,033,441	V1385A	probably damaging	Het
Nr5a2	T	C	1: 136,845,542	Y474C	probably damaging	Het
Olfr1156	A	T	2: 87,949,801		probably null	Het
Olfr1438-ps1	C	T	19: 12,333,644	D71N	probably damaging	Het
Olfr338	A	G	2: 36,377,310	D178G	probably damaging	Het
Pogz	A	G	3: 94,856,117	T67A	possibly damaging	Het
Prep	T	A	10: 45,072,129		probably null	Het
Prf1	A	G	10: 61,303,028	D255G	probably damaging	Het
Psme2	A	G	14: 55,590,082	L24P	probably damaging	Het
Scmh1	T	A	4: 120,505,515		probably null	Het
Scpep1	A	G	11: 88,929,313	V383A	possibly damaging	Het
Slc4a10	A	T	2: 62,243,431	N279I	probably benign	Het
Sphkap	T	C	1: 83,267,405	S1498G	probably benign	Het
Spinkl	C	A	18: 44,168,139	S44I	probably damaging	Het
Tanc2	G	A	11: 105,867,717	R768Q	probably damaging	Het
Tmem213	A	G	6: 38,109,451	Q14R	probably benign	Het
Tns1	A	T	1: 73,928,097	Y1172*	probably null	Het
Ugt2b37	A	C	5: 87,254,177	I198M	probably benign	Het
Usp17lb	A	C	7: 104,840,345	I457M	probably damaging	Het
Usp6nl	G	T	2: 6,441,339	R709L	probably damaging	Het
Zer1	A	G	2: 30,104,997	L462P	probably damaging	Het
Zfhx2	A	G	14: 55,074,005	S411P	probably benign	Het

Other mutations in Mroh2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00503:Mroh2b	APN	15	4899197	missense	probably benign
IGL00507:Mroh2b	APN	15	4962127	missense	probably damaging	1.00
IGL00548:Mroh2b	APN	15	4931316	missense	probably benign	0.35
IGL00902:Mroh2b	APN	15	4915222	missense	probably damaging	1.00
IGL00944:Mroh2b	APN	15	4951127	splice site	probably benign
IGL00954:Mroh2b	APN	15	4903054	missense	probably damaging	0.99
IGL01015:Mroh2b	APN	15	4941542	missense	probably damaging	1.00
IGL01134:Mroh2b	APN	15	4915152	missense	probably benign	0.00
IGL01337:Mroh2b	APN	15	4905024	missense	probably benign	0.38
IGL01780:Mroh2b	APN	15	4912000	missense	probably benign	0.01
IGL01919:Mroh2b	APN	15	4923688	missense	probably benign	0.10
IGL02069:Mroh2b	APN	15	4904324	splice site	probably benign
IGL02146:Mroh2b	APN	15	4951294	splice site	probably null
IGL02221:Mroh2b	APN	15	4923641	missense	probably damaging	1.00
IGL02281:Mroh2b	APN	15	4952263	missense	probably benign	0.04
IGL02350:Mroh2b	APN	15	4912000	missense	probably benign	0.01
IGL02357:Mroh2b	APN	15	4912000	missense	probably benign	0.01
IGL02401:Mroh2b	APN	15	4900501	missense	possibly damaging	0.71
IGL02427:Mroh2b	APN	15	4951560	splice site	probably benign
IGL02432:Mroh2b	APN	15	4914186	missense	probably benign
IGL02582:Mroh2b	APN	15	4908515	missense	probably damaging	0.98
IGL02632:Mroh2b	APN	15	4931101	missense	probably damaging	0.99
IGL02741:Mroh2b	APN	15	4905632	missense	probably benign
IGL02811:Mroh2b	APN	15	4915236	missense	possibly damaging	0.55
IGL02826:Mroh2b	APN	15	4962148	missense	probably damaging	0.99
IGL03412:Mroh2b	APN	15	4944372	missense	probably benign	0.14
PIT4468001:Mroh2b	UTSW	15	4912812	missense	probably damaging	1.00
R0024:Mroh2b	UTSW	15	4925627	missense	probably damaging	1.00
R0333:Mroh2b	UTSW	15	4931118	missense	probably damaging	1.00
R0433:Mroh2b	UTSW	15	4941634	missense	probably benign	0.01
R0530:Mroh2b	UTSW	15	4934395	missense	probably damaging	0.97
R1411:Mroh2b	UTSW	15	4918317	missense	probably damaging	1.00
R1457:Mroh2b	UTSW	15	4925684	missense	probably damaging	1.00
R1466:Mroh2b	UTSW	15	4925684	missense	probably damaging	1.00
R1466:Mroh2b	UTSW	15	4925684	missense	probably damaging	1.00
R1472:Mroh2b	UTSW	15	4948655	missense	probably benign	0.00
R1525:Mroh2b	UTSW	15	4951130	splice site	probably null
R1584:Mroh2b	UTSW	15	4925684	missense	probably damaging	1.00
R1605:Mroh2b	UTSW	15	4945090	missense	probably benign	0.08
R1657:Mroh2b	UTSW	15	4931043	nonsense	probably null
R1671:Mroh2b	UTSW	15	4951294	splice site	probably null
R1698:Mroh2b	UTSW	15	4914140	missense	probably benign	0.02
R2002:Mroh2b	UTSW	15	4925684	missense	probably damaging	1.00
R2005:Mroh2b	UTSW	15	4917158	missense	probably damaging	1.00
R2077:Mroh2b	UTSW	15	4944966	missense	probably damaging	1.00
R2179:Mroh2b	UTSW	15	4921446	critical splice donor site	probably null
R2183:Mroh2b	UTSW	15	4918225	splice site	probably null
R3713:Mroh2b	UTSW	15	4943649	missense	probably benign	0.01
R3714:Mroh2b	UTSW	15	4943649	missense	probably benign	0.01
R3747:Mroh2b	UTSW	15	4952246	nonsense	probably null
R3748:Mroh2b	UTSW	15	4952246	nonsense	probably null
R3749:Mroh2b	UTSW	15	4952246	nonsense	probably null
R3750:Mroh2b	UTSW	15	4952246	nonsense	probably null
R3792:Mroh2b	UTSW	15	4923620	missense	probably damaging	1.00
R3872:Mroh2b	UTSW	15	4925061	nonsense	probably null
R4021:Mroh2b	UTSW	15	4925100	missense	possibly damaging	0.75
R4329:Mroh2b	UTSW	15	4931379	missense	probably damaging	0.99
R4456:Mroh2b	UTSW	15	4947925	missense	probably benign	0.21
R4592:Mroh2b	UTSW	15	4918290	missense	probably damaging	1.00
R4836:Mroh2b	UTSW	15	4904270	missense	probably damaging	1.00
R5050:Mroh2b	UTSW	15	4900450	missense	possibly damaging	0.82
R5230:Mroh2b	UTSW	15	4941522	missense	probably benign	0.07
R5342:Mroh2b	UTSW	15	4914133	nonsense	probably null
R5353:Mroh2b	UTSW	15	4917178	missense	probably damaging	1.00
R5368:Mroh2b	UTSW	15	4905572	missense	probably damaging	1.00
R5424:Mroh2b	UTSW	15	4941612	missense	probably damaging	0.98
R5484:Mroh2b	UTSW	15	4908981	missense	possibly damaging	0.92
R6046:Mroh2b	UTSW	15	4951281	missense	probably benign	0.01
R6081:Mroh2b	UTSW	15	4944377	missense	probably damaging	1.00
R6162:Mroh2b	UTSW	15	4915225	missense	probably damaging	1.00
R6165:Mroh2b	UTSW	15	4918350	missense	probably benign	0.23
R6240:Mroh2b	UTSW	15	4934644	missense	probably benign	0.38
R6487:Mroh2b	UTSW	15	4947239	missense	probably damaging	1.00
R6539:Mroh2b	UTSW	15	4905574	missense	probably damaging	1.00
R6616:Mroh2b	UTSW	15	4953282	missense	probably benign	0.36
R6663:Mroh2b	UTSW	15	4947935	missense	probably benign	0.21
R6820:Mroh2b	UTSW	15	4953274	missense	probably damaging	1.00
R6900:Mroh2b	UTSW	15	4908987	missense	probably benign	0.00
R6990:Mroh2b	UTSW	15	4912802	missense	possibly damaging	0.55
R7067:Mroh2b	UTSW	15	4900504	missense	probably benign	0.35
R7092:Mroh2b	UTSW	15	4934678	missense	possibly damaging	0.92
R7102:Mroh2b	UTSW	15	4948003	missense	probably benign	0.06
R7264:Mroh2b	UTSW	15	4921362	missense	possibly damaging	0.81
R7436:Mroh2b	UTSW	15	4941554	missense	probably benign	0.21
R7462:Mroh2b	UTSW	15	4908627	missense	probably damaging	1.00
R7529:Mroh2b	UTSW	15	4949009	missense	probably damaging	1.00
R7575:Mroh2b	UTSW	15	4934605	missense	probably damaging	1.00
R7579:Mroh2b	UTSW	15	4931061	missense	probably benign	0.09
R7605:Mroh2b	UTSW	15	4945023	missense	probably damaging	1.00
R7624:Mroh2b	UTSW	15	4917131	missense	probably damaging	1.00
R7797:Mroh2b	UTSW	15	4949105	missense	probably benign	0.36
R7848:Mroh2b	UTSW	15	4938379	nonsense	probably null
R7952:Mroh2b	UTSW	15	4951211	missense	probably damaging	1.00
R7995:Mroh2b	UTSW	15	4921357	nonsense	probably null
R8088:Mroh2b	UTSW	15	4900503	missense	possibly damaging	0.57
R8207:Mroh2b	UTSW	15	4938410	missense	possibly damaging	0.95
R8242:Mroh2b	UTSW	15	4909040	missense	probably benign	0.04
R8248:Mroh2b	UTSW	15	4931104	missense	probably benign	0.40
R8258:Mroh2b	UTSW	15	4911909	missense	probably benign	0.01
R8259:Mroh2b	UTSW	15	4911909	missense	probably benign	0.01
R8304:Mroh2b	UTSW	15	4925637	missense	probably damaging	0.99
R8316:Mroh2b	UTSW	15	4951264	nonsense	probably null
R8345:Mroh2b	UTSW	15	4944326	missense	probably benign	0.09
R8507:Mroh2b	UTSW	15	4949090	missense	probably damaging	1.00
X0067:Mroh2b	UTSW	15	4951591	missense	possibly damaging	0.90
Z1177:Mroh2b	UTSW	15	4905005	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTGGCATGGTTAATGATCAGAAG -3'
(R):5'- AGTCGGATGGGAAAACTCTTCG -3'

Sequencing Primer
(F):5'- ATAGGAGAAGAAGGGGTATTGTATAG -3'
(R):5'- CGGATGGGAAAACTCTTCGATTCC -3'

Posted On

2017-06-27