Incidental Mutation 'R6000:Ercc1'
ID482113
Institutional Source Beutler Lab
Gene Symbol Ercc1
Ensembl Gene ENSMUSG00000003549
Gene Nameexcision repair cross-complementing rodent repair deficiency, complementation group 1
SynonymsErcc-1
MMRRC Submission 044179-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6000 (G1)
Quality Score128.008
Status Validated
Chromosome7
Chromosomal Location19344778-19356524 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to T at 19347161 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135767 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003645] [ENSMUST00000160369] [ENSMUST00000161378] [ENSMUST00000176818]
Predicted Effect probably benign
Transcript: ENSMUST00000003645
SMART Domains Protein: ENSMUSP00000003645
Gene: ENSMUSG00000003549

DomainStartEndE-ValueType
low complexity region 68 79 N/A INTRINSIC
Pfam:Rad10 100 213 2.9e-55 PFAM
HhH1 269 288 4.04e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160192
Predicted Effect probably benign
Transcript: ENSMUST00000160369
SMART Domains Protein: ENSMUSP00000125655
Gene: ENSMUSG00000003549

DomainStartEndE-ValueType
low complexity region 68 79 N/A INTRINSIC
Pfam:Rad10 99 166 1.6e-34 PFAM
low complexity region 232 245 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160909
Predicted Effect probably benign
Transcript: ENSMUST00000161378
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162992
Predicted Effect probably benign
Transcript: ENSMUST00000176818
SMART Domains Protein: ENSMUSP00000135767
Gene: ENSMUSG00000003549

DomainStartEndE-ValueType
Pfam:Rad10 23 90 8.4e-35 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207444
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208263
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.7%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene functions in the nucleotide excision repair pathway, and is required for the repair of DNA lesions such as those induced by UV light or formed by electrophilic compounds including cisplatin. The encoded protein forms a heterodimer with the XPF endonuclease (also known as ERCC4), and the heterodimeric endonuclease catalyzes the 5' incision in the process of excising the DNA lesion. The heterodimeric endonuclease is also involved in recombinational DNA repair and in the repair of inter-strand crosslinks. Mutations in this gene result in cerebrooculofacioskeletal syndrome, and polymorphisms that alter expression of this gene may play a role in carcinogenesis. Multiple transcript variants encoding different isoforms have been found for this gene. The last exon of this gene overlaps with the CD3e molecule, epsilon associated protein gene on the opposite strand. [provided by RefSeq, Oct 2009]
PHENOTYPE: Nullizygous mutations result in growth and liver failure, nuclear anomalies and postnatal death, and may lead to spleen hypoplasia, altered isotype switching, B cell hypoproliferation, dystonia, ataxia, renal failure, sarcopenia, kyphosis, early replicative aging and sensitivity to oxidative stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310034C09Rik T C 16: 88,759,539 C214R possibly damaging Het
5430403G16Rik A G 5: 109,676,864 V240A probably benign Het
Ahnak A T 19: 9,013,111 K3920* probably null Het
Alox12b A G 11: 69,169,568 D650G probably damaging Het
Amt A T 9: 108,301,485 Y400F probably benign Het
Ankrd11 A G 8: 122,891,195 S1973P possibly damaging Het
Aoc1 A T 6: 48,907,639 T539S probably benign Het
Arhgap44 CTGCT CTGCTTGCT 11: 65,032,084 probably null Het
Ccdc15 C T 9: 37,315,764 G292S probably benign Het
Ccdc162 C T 10: 41,561,163 C287Y possibly damaging Het
Cdk15 G A 1: 59,289,659 G244D probably damaging Het
Cep290 T A 10: 100,541,787 Y1560N probably damaging Het
Cic A C 7: 25,271,998 I385L probably benign Het
Cobl A T 11: 12,369,684 F231L probably benign Het
Cpeb1 T C 7: 81,361,680 D171G possibly damaging Het
Csnk1g2 T A 10: 80,638,944 V305E probably damaging Het
Cyp2c29 A G 19: 39,307,606 probably null Het
Dner A T 1: 84,383,929 M653K possibly damaging Het
Dst T A 1: 34,212,223 M4311K possibly damaging Het
Ep400 A G 5: 110,683,201 S2200P unknown Het
Ephb2 A T 4: 136,684,030 S440T possibly damaging Het
Folh1 T A 7: 86,725,934 N615Y probably benign Het
Gm35911 G T 5: 99,941,367 A164S probably benign Het
Gm7298 T C 6: 121,765,079 Y487H possibly damaging Het
Gucy1b2 A T 14: 62,419,050 I286N probably benign Het
Hr A G 14: 70,567,833 D1005G probably damaging Het
Ifrd1 C A 12: 40,216,244 V117F possibly damaging Het
Ift140 A T 17: 25,036,960 T210S probably benign Het
Igll1 C A 16: 16,863,941 probably benign Het
Ino80 G T 2: 119,374,508 S1512R probably benign Het
Intu A T 3: 40,654,148 K197* probably null Het
Kdm6b A G 11: 69,403,598 L1216P unknown Het
Klrb1c T G 6: 128,784,157 D169A probably damaging Het
Lamp3 T A 16: 19,700,948 T162S possibly damaging Het
Mapk10 G A 5: 102,966,475 P319L probably damaging Het
Mapk10 G A 5: 102,966,476 P319S probably damaging Het
Mical3 T C 6: 121,021,320 T702A probably benign Het
Mstn C T 1: 53,061,669 probably benign Het
Nckap1l T C 15: 103,478,815 S706P probably benign Het
Nckap5l G A 15: 99,426,885 T579I probably damaging Het
Olfr1197 C A 2: 88,729,231 A123S probably damaging Het
Olfr1341 A T 4: 118,710,244 N279I probably damaging Het
Olfr285 G A 15: 98,313,436 T38I probably benign Het
Pcdh18 A C 3: 49,754,464 S801A probably damaging Het
Pde11a A T 2: 76,017,860 D874E probably damaging Het
Pfdn6 G T 17: 33,939,615 P62T probably damaging Het
Pkd1l1 A G 11: 8,950,427 I38T probably benign Het
Prkdc A T 16: 15,829,697 I3662F possibly damaging Het
Psg26 A T 7: 18,482,692 L74* probably null Het
Rassf6 A G 5: 90,603,877 V341A probably damaging Het
Rsad2 C A 12: 26,447,151 probably null Het
Rwdd3 A G 3: 121,156,513 Y95H probably damaging Het
Scfd1 A G 12: 51,445,674 I589V possibly damaging Het
Sgsm1 A T 5: 113,286,838 I131N probably damaging Het
Tecpr1 A G 5: 144,211,421 S389P probably benign Het
Tle3 T A 9: 61,374,014 I29N probably damaging Het
Tmem63c C A 12: 87,057,197 N73K probably damaging Het
Tpm2 T A 4: 43,518,301 probably null Het
Trak2 A T 1: 58,911,812 D405E possibly damaging Het
Ttn C A 2: 76,745,172 A23380S probably damaging Het
Ttn A T 2: 76,885,151 probably benign Het
Tub T C 7: 109,029,650 S391P probably damaging Het
Ush2a G T 1: 188,267,026 E178* probably null Het
Wdr66 A G 5: 123,254,372 probably benign Het
Wisp3 T C 10: 39,158,300 Y102C probably damaging Het
Ylpm1 C A 12: 84,997,256 T256K unknown Het
Other mutations in Ercc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02929:Ercc1 APN 7 19355363 critical splice donor site probably null
joyless UTSW 7 19355177 splice site probably null
R2062:Ercc1 UTSW 7 19354370 makesense probably null
R4373:Ercc1 UTSW 7 19347132 unclassified probably benign
R4374:Ercc1 UTSW 7 19347132 unclassified probably benign
R4375:Ercc1 UTSW 7 19347132 unclassified probably benign
R4852:Ercc1 UTSW 7 19350704 missense probably damaging 1.00
R6415:Ercc1 UTSW 7 19355177 splice site probably null
X0057:Ercc1 UTSW 7 19356449 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCCTTGGCTCTGGATTTGACAT -3'
(R):5'- CTCATGACCTCTGGAAGAGC -3'

Sequencing Primer
(F):5'- CTTCCCAAGTGCTAGGATCAAAGG -3'
(R):5'- GCAGTCAGCGCTCTTAACCATTAAG -3'
Posted On2017-06-27