Incidental Mutation 'R5992:Hsd17b3'
ID 482116
Institutional Source Beutler Lab
Gene Symbol Hsd17b3
Ensembl Gene ENSMUSG00000033122
Gene Name hydroxysteroid (17-beta) dehydrogenase 3
Synonyms 17(beta)HSD type 3
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5992 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 64058266-64089230 bp(-) (GRCm38)
Type of Mutation splice site (3849 bp from exon)
DNA Base Change (assembly) T to C at 64059470 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152274 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039832] [ENSMUST00000166224] [ENSMUST00000222783] [ENSMUST00000222810]
AlphaFold P70385
Predicted Effect probably null
Transcript: ENSMUST00000039832
SMART Domains Protein: ENSMUSP00000044217
Gene: ENSMUSG00000033122

DomainStartEndE-ValueType
Pfam:adh_short 45 213 3.4e-26 PFAM
Pfam:adh_short_C2 51 272 1.2e-12 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000166224
SMART Domains Protein: ENSMUSP00000132011
Gene: ENSMUSG00000033122

DomainStartEndE-ValueType
Pfam:adh_short 45 240 2.4e-48 PFAM
Pfam:adh_short_C2 51 272 3.8e-13 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000221513
Predicted Effect probably null
Transcript: ENSMUST00000222783
Predicted Effect probably null
Transcript: ENSMUST00000222810
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This isoform of 17 beta-hydroxysteroid dehydrogenase is expressed predominantly in the testis and catalyzes the conversion of androstenedione to testosterone. It preferentially uses NADP as cofactor. Deficiency can result in male pseudohermaphroditism with gynecomastia. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 T A 17: 45,508,623 L188* probably null Het
Acod1 C T 14: 103,055,035 R332C probably damaging Het
Adamts3 T A 5: 89,691,335 K852M probably damaging Het
Adm A T 7: 110,627,696 probably benign Het
Aff4 A G 11: 53,373,010 S286G probably damaging Het
Ank2 A G 3: 126,959,651 probably null Het
Aqr A T 2: 114,143,049 Y427* probably null Het
Arid1b C A 17: 4,994,956 probably benign Het
Arpp21 T A 9: 112,143,485 R259* probably null Het
Cep290 C T 10: 100,543,321 A55V possibly damaging Het
Chsy3 GT G 18: 59,176,166 163 probably null Het
Clcn2 T C 16: 20,713,654 E68G possibly damaging Het
Corin T A 5: 72,316,389 H699L probably benign Het
Cyld T C 8: 88,733,053 Y446H probably damaging Het
Dcst1 T A 3: 89,352,576 E613V probably damaging Het
Dlk1 T C 12: 109,455,581 C74R probably damaging Het
Dnah12 A C 14: 26,697,341 K128T probably benign Het
Dspp T A 5: 104,178,451 S893R unknown Het
Dtl A T 1: 191,568,572 probably null Het
F2rl1 T A 13: 95,514,270 S35C probably benign Het
Fcgbp A T 7: 28,120,534 Y2562F probably benign Het
Fgf10 A T 13: 118,715,508 D42V probably benign Het
Gm10271 A T 10: 116,972,592 F6L probably damaging Het
Gm21190 T A 5: 15,524,851 E256D probably damaging Het
Gm5157 A G 7: 21,185,421 S66P probably damaging Het
Gm884 A T 11: 103,613,792 M2450K possibly damaging Het
Hal T G 10: 93,490,916 L138R probably damaging Het
Lrsam1 T C 2: 32,955,222 T94A probably benign Het
Macc1 T C 12: 119,447,585 V696A probably damaging Het
Magi2 G A 5: 19,227,291 M1I probably null Het
March7 C A 2: 60,245,220 N674K probably benign Het
Mfap1b A G 2: 121,470,295 V34A probably benign Het
Mob3b G A 4: 35,084,069 S40L probably benign Het
Ndufs2 A T 1: 171,236,418 V386E probably damaging Het
Nfic C T 10: 81,420,747 A19T probably damaging Het
Nfs1 G A 2: 156,134,453 R174W probably damaging Het
Nin G T 12: 70,045,524 S670R possibly damaging Het
Nrxn1 T C 17: 90,623,507 I754V probably benign Het
Nwd1 T C 8: 72,653,573 probably null Het
Olfr1231 T A 2: 89,303,359 T78S possibly damaging Het
Olfr1238 T A 2: 89,406,879 M67L probably benign Het
Olfr575 G T 7: 102,955,009 N197K probably benign Het
Pcdhgb8 A G 18: 37,763,449 E524G probably damaging Het
Phlpp1 A T 1: 106,318,993 R638* probably null Het
Pkmyt1 G C 17: 23,735,326 W360S probably benign Het
Plxnd1 C A 6: 115,967,787 probably null Het
Poldip3 A T 15: 83,129,229 N322K probably damaging Het
Prmt3 A T 7: 49,828,947 I419L probably benign Het
Prss36 A T 7: 127,944,830 V123E probably damaging Het
Prss58 A G 6: 40,897,769 I46T probably damaging Het
Rac1 T C 5: 143,506,998 probably benign Het
Rb1cc1 A G 1: 6,233,996 Y36C probably damaging Het
Rif1 C G 2: 52,095,844 L614V probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rp1 A T 1: 4,148,703 F951L unknown Het
Rps6ka5 G T 12: 100,575,250 P417T possibly damaging Het
Ryr1 A G 7: 29,067,637 W2967R probably damaging Het
Sacs T A 14: 61,205,543 S1679R probably damaging Het
Scn1a A C 2: 66,335,456 W153G probably damaging Het
Serpinb7 A G 1: 107,445,996 Y114C probably damaging Het
Son T C 16: 91,658,904 M1513T probably benign Het
Spag8 C T 4: 43,651,534 V447M probably benign Het
St3gal2 T A 8: 110,969,553 Y257N probably damaging Het
Tars A T 15: 11,397,196 D40E probably damaging Het
Tlr3 T C 8: 45,397,814 H158R probably benign Het
Tppp2 G T 14: 51,918,935 V50L probably benign Het
Trrap T C 5: 144,810,184 S1503P probably benign Het
Ttll4 T G 1: 74,685,391 S573R probably damaging Het
Vmn2r104 A T 17: 20,029,485 N841K probably damaging Het
Vmn2r3 A T 3: 64,259,647 C688S probably damaging Het
Vps16 T C 2: 130,424,449 probably null Het
Zfp608 G A 18: 54,899,248 T540I probably benign Het
Zfp775 G A 6: 48,619,816 R208Q probably damaging Het
Other mutations in Hsd17b3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01407:Hsd17b3 APN 13 64062905 missense probably damaging 1.00
IGL02221:Hsd17b3 APN 13 64089051 missense probably benign 0.01
IGL02257:Hsd17b3 APN 13 64059462 missense probably benign 0.14
IGL02745:Hsd17b3 APN 13 64087176 missense probably benign 0.01
IGL03189:Hsd17b3 APN 13 64063087 critical splice donor site probably null
hermine UTSW 13 64062906 missense probably damaging 1.00
IGL02988:Hsd17b3 UTSW 13 64089100 missense probably damaging 0.96
R0116:Hsd17b3 UTSW 13 64058589 missense possibly damaging 0.87
R0659:Hsd17b3 UTSW 13 64073936 missense possibly damaging 0.87
R0684:Hsd17b3 UTSW 13 64089068 missense probably benign
R0834:Hsd17b3 UTSW 13 64089122 missense probably benign 0.00
R3750:Hsd17b3 UTSW 13 64063179 splice site probably null
R3845:Hsd17b3 UTSW 13 64089062 missense possibly damaging 0.94
R3973:Hsd17b3 UTSW 13 64059486 missense probably damaging 1.00
R4602:Hsd17b3 UTSW 13 64063170 critical splice acceptor site probably null
R5027:Hsd17b3 UTSW 13 64062906 missense probably damaging 1.00
R5470:Hsd17b3 UTSW 13 64073899 missense probably damaging 1.00
R5897:Hsd17b3 UTSW 13 64088985 critical splice donor site probably null
R6898:Hsd17b3 UTSW 13 64059525 missense probably benign 0.06
R7297:Hsd17b3 UTSW 13 64076351 missense probably damaging 1.00
R7555:Hsd17b3 UTSW 13 64072002 missense probably benign 0.17
R8743:Hsd17b3 UTSW 13 64062898 missense probably benign 0.00
R8786:Hsd17b3 UTSW 13 64072048 missense probably damaging 1.00
R8904:Hsd17b3 UTSW 13 64064380 missense probably damaging 1.00
R8994:Hsd17b3 UTSW 13 64062881 missense probably damaging 1.00
R9324:Hsd17b3 UTSW 13 64058645 missense possibly damaging 0.49
Z1176:Hsd17b3 UTSW 13 64063138 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GTACTGCAGCATGCTAGTCC -3'
(R):5'- TTTCACAGGCAGAAGGGAGC -3'

Sequencing Primer
(F):5'- AGCATGCTAGTCCCGTGAG -3'
(R):5'- CTAGACATGCATGGTGAAACGTGTG -3'
Posted On 2017-06-27