Incidental Mutation 'R5994:Prrc2c'
ID 482119
Institutional Source Beutler Lab
Gene Symbol Prrc2c
Ensembl Gene ENSMUSG00000040225
Gene Name proline-rich coiled-coil 2C
Synonyms 9630039I18Rik, Bat2d, 1810043M20Rik, Bat2l2
MMRRC Submission 044173-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.410) question?
Stock # R5994 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 162499354-162568125 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) A to T at 162501725 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000138451 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028016] [ENSMUST00000182149] [ENSMUST00000182393] [ENSMUST00000182593] [ENSMUST00000182660] [ENSMUST00000183223]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000028016
SMART Domains Protein: ENSMUSP00000028016
Gene: ENSMUSG00000040225

DomainStartEndE-ValueType
Pfam:BAT2_N 1 164 7.7e-56 PFAM
internal_repeat_2 167 349 4.39e-5 PROSPERO
internal_repeat_1 336 391 2.14e-5 PROSPERO
low complexity region 407 414 N/A INTRINSIC
SCOP:d1eq1a_ 447 591 2e-5 SMART
low complexity region 649 669 N/A INTRINSIC
low complexity region 733 745 N/A INTRINSIC
coiled coil region 996 1026 N/A INTRINSIC
low complexity region 1157 1186 N/A INTRINSIC
low complexity region 1212 1222 N/A INTRINSIC
internal_repeat_1 1240 1295 2.14e-5 PROSPERO
low complexity region 1308 1335 N/A INTRINSIC
low complexity region 1388 1409 N/A INTRINSIC
low complexity region 1715 1746 N/A INTRINSIC
low complexity region 1765 1803 N/A INTRINSIC
low complexity region 1815 1832 N/A INTRINSIC
low complexity region 1844 1909 N/A INTRINSIC
internal_repeat_2 1962 2148 4.39e-5 PROSPERO
low complexity region 2163 2177 N/A INTRINSIC
low complexity region 2230 2252 N/A INTRINSIC
low complexity region 2272 2286 N/A INTRINSIC
low complexity region 2321 2338 N/A INTRINSIC
low complexity region 2427 2438 N/A INTRINSIC
low complexity region 2553 2576 N/A INTRINSIC
low complexity region 2811 2828 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000182149
SMART Domains Protein: ENSMUSP00000138548
Gene: ENSMUSG00000040225

DomainStartEndE-ValueType
Pfam:BAT2_N 1 167 5.6e-73 PFAM
internal_repeat_1 336 391 1.49e-5 PROSPERO
low complexity region 407 414 N/A INTRINSIC
SCOP:d1eq1a_ 447 591 2e-5 SMART
low complexity region 649 669 N/A INTRINSIC
low complexity region 733 745 N/A INTRINSIC
internal_repeat_3 754 925 9.16e-5 PROSPERO
coiled coil region 996 1026 N/A INTRINSIC
low complexity region 1157 1186 N/A INTRINSIC
low complexity region 1212 1222 N/A INTRINSIC
internal_repeat_1 1240 1295 1.49e-5 PROSPERO
low complexity region 1308 1335 N/A INTRINSIC
low complexity region 1388 1409 N/A INTRINSIC
low complexity region 1715 1746 N/A INTRINSIC
low complexity region 1765 1803 N/A INTRINSIC
low complexity region 1815 1832 N/A INTRINSIC
low complexity region 1844 1909 N/A INTRINSIC
internal_repeat_2 1962 2148 3.08e-5 PROSPERO
internal_repeat_3 1983 2153 9.16e-5 PROSPERO
low complexity region 2163 2177 N/A INTRINSIC
low complexity region 2230 2252 N/A INTRINSIC
low complexity region 2272 2286 N/A INTRINSIC
low complexity region 2321 2338 N/A INTRINSIC
low complexity region 2427 2438 N/A INTRINSIC
low complexity region 2553 2576 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000182393
SMART Domains Protein: ENSMUSP00000138451
Gene: ENSMUSG00000040225

DomainStartEndE-ValueType
low complexity region 24 51 N/A INTRINSIC
low complexity region 104 125 N/A INTRINSIC
low complexity region 431 462 N/A INTRINSIC
low complexity region 481 519 N/A INTRINSIC
low complexity region 531 548 N/A INTRINSIC
low complexity region 560 625 N/A INTRINSIC
low complexity region 879 893 N/A INTRINSIC
low complexity region 946 968 N/A INTRINSIC
low complexity region 988 1002 N/A INTRINSIC
low complexity region 1037 1054 N/A INTRINSIC
low complexity region 1143 1154 N/A INTRINSIC
low complexity region 1274 1297 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182593
SMART Domains Protein: ENSMUSP00000138674
Gene: ENSMUSG00000040225

DomainStartEndE-ValueType
Pfam:BAT2_N 1 165 4.1e-70 PFAM
internal_repeat_1 334 389 9.57e-6 PROSPERO
low complexity region 405 412 N/A INTRINSIC
SCOP:d1eq1a_ 445 589 3e-5 SMART
low complexity region 647 667 N/A INTRINSIC
low complexity region 731 743 N/A INTRINSIC
internal_repeat_3 752 923 6.11e-5 PROSPERO
coiled coil region 994 1024 N/A INTRINSIC
low complexity region 1155 1184 N/A INTRINSIC
low complexity region 1210 1220 N/A INTRINSIC
internal_repeat_1 1238 1293 9.57e-6 PROSPERO
low complexity region 1306 1333 N/A INTRINSIC
low complexity region 1386 1407 N/A INTRINSIC
low complexity region 1713 1744 N/A INTRINSIC
low complexity region 1763 1801 N/A INTRINSIC
low complexity region 1813 1830 N/A INTRINSIC
low complexity region 1842 1907 N/A INTRINSIC
internal_repeat_2 1960 2146 2.01e-5 PROSPERO
internal_repeat_3 1981 2151 6.11e-5 PROSPERO
low complexity region 2161 2175 N/A INTRINSIC
low complexity region 2228 2250 N/A INTRINSIC
low complexity region 2270 2284 N/A INTRINSIC
low complexity region 2319 2336 N/A INTRINSIC
low complexity region 2425 2436 N/A INTRINSIC
low complexity region 2551 2574 N/A INTRINSIC
low complexity region 2671 2682 N/A INTRINSIC
low complexity region 2730 2747 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182660
SMART Domains Protein: ENSMUSP00000138433
Gene: ENSMUSG00000040225

DomainStartEndE-ValueType
Pfam:BAT2_N 1 167 7e-73 PFAM
internal_repeat_1 336 391 2.14e-5 PROSPERO
low complexity region 407 414 N/A INTRINSIC
SCOP:d1eq1a_ 447 591 2e-5 SMART
low complexity region 649 669 N/A INTRINSIC
low complexity region 733 745 N/A INTRINSIC
coiled coil region 996 1026 N/A INTRINSIC
low complexity region 1157 1186 N/A INTRINSIC
low complexity region 1212 1222 N/A INTRINSIC
internal_repeat_1 1240 1295 2.14e-5 PROSPERO
low complexity region 1308 1335 N/A INTRINSIC
low complexity region 1388 1409 N/A INTRINSIC
low complexity region 1715 1746 N/A INTRINSIC
low complexity region 1765 1803 N/A INTRINSIC
low complexity region 1815 1832 N/A INTRINSIC
low complexity region 1844 1909 N/A INTRINSIC
internal_repeat_2 1962 2148 4.39e-5 PROSPERO
low complexity region 2163 2177 N/A INTRINSIC
low complexity region 2230 2252 N/A INTRINSIC
low complexity region 2272 2286 N/A INTRINSIC
low complexity region 2321 2338 N/A INTRINSIC
low complexity region 2427 2438 N/A INTRINSIC
low complexity region 2553 2576 N/A INTRINSIC
low complexity region 2811 2828 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183223
SMART Domains Protein: ENSMUSP00000138698
Gene: ENSMUSG00000040225

DomainStartEndE-ValueType
low complexity region 289 320 N/A INTRINSIC
low complexity region 339 377 N/A INTRINSIC
low complexity region 389 406 N/A INTRINSIC
low complexity region 418 483 N/A INTRINSIC
low complexity region 739 761 N/A INTRINSIC
low complexity region 781 795 N/A INTRINSIC
low complexity region 830 847 N/A INTRINSIC
low complexity region 936 947 N/A INTRINSIC
low complexity region 1062 1085 N/A INTRINSIC
low complexity region 1182 1193 N/A INTRINSIC
low complexity region 1241 1258 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184547
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A T 6: 121,647,862 (GRCm39) H1118L probably benign Het
Abca8b A G 11: 109,840,592 (GRCm39) probably null Het
Abcb5 A T 12: 118,928,995 (GRCm39) probably null Het
Adcy6 A T 15: 98,491,545 (GRCm39) I1016N probably damaging Het
Afg3l2 A T 18: 67,562,140 (GRCm39) C312S probably damaging Het
Ano8 C T 8: 71,937,478 (GRCm39) V89M probably damaging Het
Arhgap21 C T 2: 20,886,187 (GRCm39) G330D possibly damaging Het
Caskin1 T C 17: 24,715,935 (GRCm39) L195P probably damaging Het
Cfap54 A G 10: 92,874,943 (GRCm39) I514T probably damaging Het
Ctdsp2 G A 10: 126,831,689 (GRCm39) probably benign Het
Cyp4x1 T C 4: 114,979,142 (GRCm39) I152V probably benign Het
Dglucy G A 12: 100,808,959 (GRCm39) R219Q probably benign Het
Disp3 G T 4: 148,338,741 (GRCm39) A810E possibly damaging Het
Dtx4 T C 19: 12,478,517 (GRCm39) Y22C probably damaging Het
Edaradd A T 13: 12,493,377 (GRCm39) I105N probably damaging Het
Eepd1 C T 9: 25,514,749 (GRCm39) P519S probably damaging Het
Fscn3 A T 6: 28,430,294 (GRCm39) S155C probably benign Het
Gm10134 A T 2: 28,396,258 (GRCm39) E51V probably damaging Het
Gm7247 C T 14: 51,601,805 (GRCm39) S26F probably benign Het
Golga7 T C 8: 23,740,281 (GRCm39) E83G probably benign Het
Gpr12 T C 5: 146,520,241 (GRCm39) H227R probably damaging Het
Hoxa2 T G 6: 52,141,372 (GRCm39) S85R possibly damaging Het
Hrnr T C 3: 93,239,607 (GRCm39) S3282P unknown Het
Ift74 C A 4: 94,579,961 (GRCm39) T543K possibly damaging Het
Klf10 C A 15: 38,296,285 (GRCm39) R420L probably damaging Het
Krt77 T A 15: 101,771,290 (GRCm39) I338F probably damaging Het
Limch1 A T 5: 67,131,965 (GRCm39) S152C probably damaging Het
Mgat4e T A 1: 134,469,234 (GRCm39) H270L probably benign Het
Myrf A T 19: 10,196,481 (GRCm39) L504Q probably null Het
Nckipsd A G 9: 108,691,176 (GRCm39) Q366R probably benign Het
Npy5r A T 8: 67,134,751 (GRCm39) V14D probably benign Het
Nrap T A 19: 56,340,031 (GRCm39) R830* probably null Het
Ogfrl1 A T 1: 23,418,070 (GRCm39) Y103N probably damaging Het
Or10g7 A T 9: 39,905,519 (GRCm39) R138* probably null Het
P2rx4 T A 5: 122,863,142 (GRCm39) L232H probably damaging Het
Pabpc2 A T 18: 39,906,947 (GRCm39) T71S probably benign Het
Paip2b C A 6: 83,785,867 (GRCm39) S121I probably damaging Het
Pofut1 C T 2: 153,103,149 (GRCm39) T261I possibly damaging Het
Ppp6c G T 2: 39,101,004 (GRCm39) T46K possibly damaging Het
Prkd2 C A 7: 16,584,261 (GRCm39) H371Q probably benign Het
Psd3 C T 8: 68,172,620 (GRCm39) A894T probably damaging Het
Pygm A T 19: 6,448,073 (GRCm39) probably null Het
Pzp A T 6: 128,468,560 (GRCm39) M989K probably damaging Het
Ralgapa2 A T 2: 146,203,373 (GRCm39) S1159T probably benign Het
Rapgefl1 T C 11: 98,740,986 (GRCm39) F575L probably benign Het
Rassf6 A G 5: 90,765,627 (GRCm39) L28S probably damaging Het
Rbp3 G T 14: 33,676,857 (GRCm39) K268N probably damaging Het
Rela C T 19: 5,697,092 (GRCm39) T433M possibly damaging Het
Rnf103 T A 6: 71,473,894 (GRCm39) S102R probably damaging Het
Scarf2 A G 16: 17,624,243 (GRCm39) N516S probably damaging Het
Sdcbp2 T C 2: 151,429,403 (GRCm39) I241T probably damaging Het
Septin7 T C 9: 25,199,494 (GRCm39) I131T possibly damaging Het
Sh3pxd2b T C 11: 32,357,570 (GRCm39) F191L probably damaging Het
Siglec15 C A 18: 78,090,590 (GRCm39) C236F probably damaging Het
Slc11a2 T C 15: 100,295,562 (GRCm39) T520A probably benign Het
Slc26a11 C A 11: 119,270,738 (GRCm39) F553L probably benign Het
Smchd1 G A 17: 71,672,404 (GRCm39) P1596S possibly damaging Het
Taar7b A G 10: 23,876,246 (GRCm39) H137R probably damaging Het
Thap12 T A 7: 98,365,237 (GRCm39) C468* probably null Het
Timp4 C T 6: 115,224,315 (GRCm39) G118D probably damaging Het
Tnnt3 A G 7: 142,065,003 (GRCm39) K48E probably damaging Het
Trmt10a T A 3: 137,862,475 (GRCm39) I255N probably damaging Het
Ttll10 T C 4: 156,133,189 (GRCm39) probably null Het
Tut7 T G 13: 59,937,023 (GRCm39) Y806S probably damaging Het
Ube4b A G 4: 149,457,389 (GRCm39) Y283H probably damaging Het
Ucp1 G T 8: 84,020,567 (GRCm39) V126L possibly damaging Het
Unc13b T A 4: 43,172,596 (GRCm39) probably benign Het
Vps13b T C 15: 35,875,918 (GRCm39) S2768P probably damaging Het
Zfp101 T A 17: 33,599,936 (GRCm39) M607L probably benign Het
Zfp292 C T 4: 34,805,464 (GRCm39) V2527M possibly damaging Het
Zfp503 T A 14: 22,035,630 (GRCm39) T429S possibly damaging Het
Other mutations in Prrc2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Prrc2c APN 1 162,548,182 (GRCm39) splice site probably null
IGL00577:Prrc2c APN 1 162,525,685 (GRCm39) missense unknown
IGL00580:Prrc2c APN 1 162,525,685 (GRCm39) missense unknown
IGL01295:Prrc2c APN 1 162,510,061 (GRCm39) missense probably damaging 1.00
IGL01554:Prrc2c APN 1 162,538,355 (GRCm39) missense probably damaging 0.99
IGL01684:Prrc2c APN 1 162,534,031 (GRCm39) unclassified probably benign
IGL01745:Prrc2c APN 1 162,552,297 (GRCm39) missense probably damaging 1.00
IGL01770:Prrc2c APN 1 162,532,068 (GRCm39) missense probably benign 0.23
IGL01905:Prrc2c APN 1 162,532,898 (GRCm39) unclassified probably benign
IGL02304:Prrc2c APN 1 162,511,705 (GRCm39) missense probably benign 0.05
IGL02389:Prrc2c APN 1 162,520,439 (GRCm39) missense probably damaging 1.00
IGL02540:Prrc2c APN 1 162,550,706 (GRCm39) missense probably damaging 1.00
IGL02681:Prrc2c APN 1 162,533,181 (GRCm39) unclassified probably benign
IGL02686:Prrc2c APN 1 162,535,516 (GRCm39) unclassified probably benign
IGL02795:Prrc2c APN 1 162,541,868 (GRCm39) missense probably benign
IGL02894:Prrc2c APN 1 162,505,626 (GRCm39) missense probably damaging 1.00
IGL02957:Prrc2c APN 1 162,534,104 (GRCm39) unclassified probably benign
IGL02981:Prrc2c APN 1 162,532,748 (GRCm39) unclassified probably benign
IGL03070:Prrc2c APN 1 162,504,978 (GRCm39) missense probably damaging 1.00
IGL03096:Prrc2c APN 1 162,529,928 (GRCm39) missense unknown
R0058:Prrc2c UTSW 1 162,526,453 (GRCm39) missense unknown
R0058:Prrc2c UTSW 1 162,526,453 (GRCm39) missense unknown
R0135:Prrc2c UTSW 1 162,543,052 (GRCm39) splice site probably benign
R0279:Prrc2c UTSW 1 162,543,033 (GRCm39) missense probably damaging 1.00
R0363:Prrc2c UTSW 1 162,525,380 (GRCm39) missense unknown
R0436:Prrc2c UTSW 1 162,532,883 (GRCm39) unclassified probably benign
R0605:Prrc2c UTSW 1 162,509,995 (GRCm39) missense probably damaging 1.00
R0696:Prrc2c UTSW 1 162,536,421 (GRCm39) critical splice donor site probably null
R0981:Prrc2c UTSW 1 162,533,550 (GRCm39) unclassified probably benign
R1693:Prrc2c UTSW 1 162,546,282 (GRCm39) missense probably damaging 0.98
R1714:Prrc2c UTSW 1 162,504,945 (GRCm39) missense probably damaging 1.00
R1791:Prrc2c UTSW 1 162,532,551 (GRCm39) unclassified probably benign
R1794:Prrc2c UTSW 1 162,533,528 (GRCm39) unclassified probably benign
R1998:Prrc2c UTSW 1 162,532,487 (GRCm39) unclassified probably benign
R2040:Prrc2c UTSW 1 162,525,126 (GRCm39) missense probably damaging 1.00
R2168:Prrc2c UTSW 1 162,537,903 (GRCm39) unclassified probably benign
R2246:Prrc2c UTSW 1 162,535,360 (GRCm39) unclassified probably benign
R2830:Prrc2c UTSW 1 162,536,485 (GRCm39) unclassified probably benign
R2926:Prrc2c UTSW 1 162,533,696 (GRCm39) unclassified probably benign
R3703:Prrc2c UTSW 1 162,538,260 (GRCm39) missense probably damaging 1.00
R3745:Prrc2c UTSW 1 162,525,754 (GRCm39) missense unknown
R3760:Prrc2c UTSW 1 162,520,420 (GRCm39) missense probably damaging 1.00
R3784:Prrc2c UTSW 1 162,537,238 (GRCm39) unclassified probably benign
R3959:Prrc2c UTSW 1 162,536,461 (GRCm39) unclassified probably benign
R4255:Prrc2c UTSW 1 162,533,895 (GRCm39) unclassified probably benign
R4276:Prrc2c UTSW 1 162,501,160 (GRCm39) missense probably damaging 1.00
R4421:Prrc2c UTSW 1 162,536,630 (GRCm39) unclassified probably benign
R4593:Prrc2c UTSW 1 162,525,101 (GRCm39) missense probably damaging 1.00
R4651:Prrc2c UTSW 1 162,550,843 (GRCm39) missense probably damaging 1.00
R4652:Prrc2c UTSW 1 162,550,843 (GRCm39) missense probably damaging 1.00
R4660:Prrc2c UTSW 1 162,508,464 (GRCm39) missense probably damaging 1.00
R4677:Prrc2c UTSW 1 162,532,748 (GRCm39) unclassified probably benign
R4688:Prrc2c UTSW 1 162,525,256 (GRCm39) missense unknown
R4753:Prrc2c UTSW 1 162,518,799 (GRCm39) missense probably damaging 1.00
R4790:Prrc2c UTSW 1 162,538,050 (GRCm39) missense unknown
R4981:Prrc2c UTSW 1 162,520,116 (GRCm39) missense probably damaging 1.00
R4995:Prrc2c UTSW 1 162,532,879 (GRCm39) unclassified probably benign
R5119:Prrc2c UTSW 1 162,533,009 (GRCm39) unclassified probably benign
R5127:Prrc2c UTSW 1 162,525,415 (GRCm39) missense unknown
R5291:Prrc2c UTSW 1 162,533,151 (GRCm39) unclassified probably benign
R5474:Prrc2c UTSW 1 162,537,213 (GRCm39) unclassified probably benign
R5543:Prrc2c UTSW 1 162,501,080 (GRCm39) missense probably damaging 0.99
R5579:Prrc2c UTSW 1 162,508,327 (GRCm39) critical splice donor site probably null
R5594:Prrc2c UTSW 1 162,526,600 (GRCm39) missense unknown
R5620:Prrc2c UTSW 1 162,501,098 (GRCm39) missense probably damaging 1.00
R6142:Prrc2c UTSW 1 162,537,956 (GRCm39) missense unknown
R6199:Prrc2c UTSW 1 162,510,085 (GRCm39) missense probably damaging 1.00
R6277:Prrc2c UTSW 1 162,541,883 (GRCm39) missense probably benign
R6504:Prrc2c UTSW 1 162,525,364 (GRCm39) missense unknown
R6671:Prrc2c UTSW 1 162,525,154 (GRCm39) missense probably damaging 1.00
R6785:Prrc2c UTSW 1 162,536,670 (GRCm39) unclassified probably benign
R6799:Prrc2c UTSW 1 162,536,630 (GRCm39) unclassified probably benign
R6801:Prrc2c UTSW 1 162,536,630 (GRCm39) unclassified probably benign
R6850:Prrc2c UTSW 1 162,536,630 (GRCm39) unclassified probably benign
R6851:Prrc2c UTSW 1 162,536,630 (GRCm39) unclassified probably benign
R6856:Prrc2c UTSW 1 162,509,940 (GRCm39) missense probably damaging 1.00
R6869:Prrc2c UTSW 1 162,536,630 (GRCm39) unclassified probably benign
R6882:Prrc2c UTSW 1 162,536,630 (GRCm39) unclassified probably benign
R6884:Prrc2c UTSW 1 162,536,630 (GRCm39) unclassified probably benign
R6897:Prrc2c UTSW 1 162,533,075 (GRCm39) unclassified probably benign
R6934:Prrc2c UTSW 1 162,548,074 (GRCm39) missense probably benign 0.10
R6976:Prrc2c UTSW 1 162,520,413 (GRCm39) missense probably damaging 1.00
R7132:Prrc2c UTSW 1 162,508,850 (GRCm39) missense possibly damaging 0.77
R7165:Prrc2c UTSW 1 162,501,086 (GRCm39) missense possibly damaging 0.94
R7282:Prrc2c UTSW 1 162,507,543 (GRCm39) missense possibly damaging 0.59
R7467:Prrc2c UTSW 1 162,504,932 (GRCm39) missense possibly damaging 0.84
R7915:Prrc2c UTSW 1 162,519,977 (GRCm39) missense probably benign 0.39
R8068:Prrc2c UTSW 1 162,536,630 (GRCm39) unclassified probably benign
R8529:Prrc2c UTSW 1 162,536,663 (GRCm39) unclassified probably benign
R8734:Prrc2c UTSW 1 162,507,081 (GRCm39) missense possibly damaging 0.92
R8735:Prrc2c UTSW 1 162,537,127 (GRCm39) missense unknown
R8813:Prrc2c UTSW 1 162,532,812 (GRCm39) missense unknown
R8946:Prrc2c UTSW 1 162,536,478 (GRCm39) unclassified probably benign
R8975:Prrc2c UTSW 1 162,533,630 (GRCm39) missense unknown
R9035:Prrc2c UTSW 1 162,503,295 (GRCm39) missense possibly damaging 0.96
R9185:Prrc2c UTSW 1 162,532,212 (GRCm39) missense unknown
R9261:Prrc2c UTSW 1 162,505,622 (GRCm39) missense possibly damaging 0.48
R9287:Prrc2c UTSW 1 162,541,843 (GRCm39) missense probably benign 0.34
R9289:Prrc2c UTSW 1 162,507,130 (GRCm39) missense probably benign 0.33
R9466:Prrc2c UTSW 1 162,503,258 (GRCm39) missense possibly damaging 0.53
R9523:Prrc2c UTSW 1 162,525,298 (GRCm39) missense unknown
R9542:Prrc2c UTSW 1 162,508,359 (GRCm39) missense possibly damaging 0.88
R9629:Prrc2c UTSW 1 162,519,959 (GRCm39) missense possibly damaging 0.95
R9744:Prrc2c UTSW 1 162,505,733 (GRCm39) missense possibly damaging 0.96
R9748:Prrc2c UTSW 1 162,535,435 (GRCm39) missense unknown
X0020:Prrc2c UTSW 1 162,535,416 (GRCm39) unclassified probably benign
X0039:Prrc2c UTSW 1 162,532,362 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- CTGCTTGCACAGTCTGAAAG -3'
(R):5'- TACCAGTAGAACATGAAGGAGCTC -3'

Sequencing Primer
(F):5'- TGCTTGCACAGTCTGAAAGCATAC -3'
(R):5'- ACATGAAGGAGCTCTTGTGG -3'
Posted On 2017-06-27