Incidental Mutation 'R5995:Olfr1446'
ID482123
Institutional Source Beutler Lab
Gene Symbol Olfr1446
Ensembl Gene ENSMUSG00000057817
Gene Nameolfactory receptor 1446
SynonymsGA_x6K02T2RE5P-3220047-3219130, MOR202-2
MMRRC Submission 044174-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R5995 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location12888266-12893524 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to C at 12890597 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000149198 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081236] [ENSMUST00000207741] [ENSMUST00000207741] [ENSMUST00000216805] [ENSMUST00000216805]
Predicted Effect probably null
Transcript: ENSMUST00000081236
SMART Domains Protein: ENSMUSP00000079994
Gene: ENSMUSG00000057817

DomainStartEndE-ValueType
Pfam:7tm_4 32 308 2e-51 PFAM
Pfam:7TM_GPCR_Srsx 36 306 5.1e-6 PFAM
Pfam:7tm_1 42 291 9.7e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207319
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207319
Predicted Effect probably null
Transcript: ENSMUST00000207741
Predicted Effect probably null
Transcript: ENSMUST00000207741
Predicted Effect probably null
Transcript: ENSMUST00000216805
Predicted Effect probably null
Transcript: ENSMUST00000216805
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.7%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb8 C T 5: 24,400,139 R108C possibly damaging Het
Adgrb2 C A 4: 130,017,103 A1104E probably damaging Het
Adgrv1 A G 13: 81,466,259 V4005A probably benign Het
Bend6 T C 1: 33,878,439 probably null Het
Brwd1 A T 16: 96,064,787 V265E probably damaging Het
Ccdc96 A G 5: 36,486,374 I575V probably damaging Het
Cd109 A T 9: 78,700,279 I1094L probably benign Het
Cd44 A G 2: 102,861,670 V91A probably damaging Het
Cdv3 C G 9: 103,364,003 G122R probably damaging Het
Ces2c T A 8: 104,850,901 V272D possibly damaging Het
Colgalt1 T A 8: 71,623,110 M467K probably damaging Het
Crtam G A 9: 40,994,540 T31M possibly damaging Het
Cyp7a1 C T 4: 6,272,371 V281M possibly damaging Het
Dnah7a A T 1: 53,620,670 N726K probably benign Het
Dok6 T C 18: 89,421,018 E232G possibly damaging Het
Gm12185 T C 11: 48,915,713 E217G probably benign Het
Gm7247 C T 14: 51,364,348 S26F probably benign Het
Gria1 A T 11: 57,289,285 Y618F probably damaging Het
H2-T22 A G 17: 36,041,485 Y183H probably benign Het
Hace1 A T 10: 45,670,391 I374L probably benign Het
Hif3a T A 7: 17,053,769 T132S probably benign Het
Hoxa3 T A 6: 52,170,283 probably benign Het
Il27 A C 7: 126,589,363 probably benign Het
Kdelc2 T C 9: 53,395,895 Y380H probably damaging Het
Klhdc1 T C 12: 69,250,774 Y40H probably damaging Het
Klhl33 T G 14: 50,892,651 E462A possibly damaging Het
Myh10 T C 11: 68,814,983 I1979T probably benign Het
Nfkbil1 G T 17: 35,220,798 F246L probably benign Het
Nlrp1b A T 11: 71,181,746 F424I probably damaging Het
Nod1 A G 6: 54,944,554 Y260H probably damaging Het
Ofcc1 A G 13: 40,280,422 L69P probably damaging Het
Olfr1110 T C 2: 87,135,856 N155S probably damaging Het
Olfr1419 A T 19: 11,870,862 I118N possibly damaging Het
Olfr385 T C 11: 73,589,250 I163V probably benign Het
Olfr968 A G 9: 39,772,692 V36A probably benign Het
Olfr98 C A 17: 37,263,648 Q5H probably benign Het
Onecut2 G T 18: 64,341,548 R390L probably damaging Het
Oprm1 A C 10: 6,832,520 M388L probably benign Het
Pcdhgc5 T A 18: 37,821,060 Y462* probably null Het
Pex1 T A 5: 3,607,704 M425K possibly damaging Het
Plec A T 15: 76,185,905 Y1001N probably damaging Het
Pou2f2 T G 7: 25,097,444 K236Q probably damaging Het
Rbm20 G A 19: 53,851,267 E896K possibly damaging Het
Sh3tc2 T A 18: 61,990,010 L614Q probably damaging Het
Skint5 T A 4: 113,893,832 I339F unknown Het
Slc2a7 T C 4: 150,168,340 I479T probably damaging Het
Snrk A G 9: 122,157,222 N219S probably damaging Het
Supt20 T C 3: 54,709,053 S245P probably damaging Het
Ttn A G 2: 76,761,292 I21011T probably damaging Het
Vmn2r11 T A 5: 109,047,055 I802F probably damaging Het
Vmn2r92 T C 17: 18,168,951 probably null Het
Ythdc2 T A 18: 44,886,253 M1363K probably damaging Het
Zan T C 5: 137,378,809 probably benign Het
Zfp521 C A 18: 13,717,624 C1261F probably damaging Het
Zfp980 A T 4: 145,701,909 K403* probably null Het
Other mutations in Olfr1446
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Olfr1446 APN 19 12889918 missense probably benign 0.00
IGL01399:Olfr1446 APN 19 12890439 missense probably benign 0.28
IGL01697:Olfr1446 APN 19 12890467 missense probably benign 0.24
IGL01739:Olfr1446 APN 19 12890149 missense probably benign 0.02
IGL01894:Olfr1446 APN 19 12889643 utr 3 prime probably benign
R0164:Olfr1446 UTSW 19 12890445 missense probably damaging 1.00
R0164:Olfr1446 UTSW 19 12890445 missense probably damaging 1.00
R1163:Olfr1446 UTSW 19 12890149 missense probably benign 0.02
R1769:Olfr1446 UTSW 19 12889683 missense probably damaging 1.00
R4406:Olfr1446 UTSW 19 12890234 nonsense probably null
R5038:Olfr1446 UTSW 19 12890406 missense probably damaging 1.00
R5207:Olfr1446 UTSW 19 12890437 missense probably benign 0.28
R5627:Olfr1446 UTSW 19 12890299 missense probably damaging 1.00
R8043:Olfr1446 UTSW 19 12889731 missense probably damaging 1.00
R8254:Olfr1446 UTSW 19 12890485 missense probably benign 0.00
X0062:Olfr1446 UTSW 19 12890563 missense probably benign 0.42
Predicted Primers PCR Primer
(F):5'- GAGAGTCCAGGACAATCAGC -3'
(R):5'- TTCACCCAAGTTAATTCTAAAGCCC -3'

Sequencing Primer
(F):5'- AATCAGCAGGATCATCCCTAGGTTTC -3'
(R):5'- AAGCCCGCATTATCTTCTGGAATG -3'
Posted On2017-06-27