Incidental Mutation 'R5977:Hey1'
ID482131
Institutional Source Beutler Lab
Gene Symbol Hey1
Ensembl Gene ENSMUSG00000040289
Gene Namehairy/enhancer-of-split related with YRPW motif 1
SynonymsHRT1, CHF2, hesr-1, bHLHb31, Herp2, Hesr1
MMRRC Submission 044159-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5977 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location8663359-8667256 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 8666358 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000038014 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042412]
Predicted Effect probably null
Transcript: ENSMUST00000042412
SMART Domains Protein: ENSMUSP00000038014
Gene: ENSMUSG00000040289

DomainStartEndE-ValueType
HLH 55 110 2.3e-14 SMART
ORANGE 120 167 2.8e-14 SMART
low complexity region 186 197 N/A INTRINSIC
low complexity region 232 244 N/A INTRINSIC
low complexity region 246 277 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192102
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192550
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194299
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency 97% (72/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein belonging to the hairy and enhancer of split-related (HESR) family of basic helix-loop-helix (bHLH)-type transcriptional repressors. Expression of this gene is induced by the Notch and c-Jun signal transduction pathways. Two similar and redundant genes in mouse are required for embryonic cardiovascular development, and are also implicated in neurogenesis and somitogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are healthy and fertile with no major developmental defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik A T 10: 100,615,244 R446S probably damaging Het
2900092C05Rik A T 7: 12,554,737 H159L probably benign Het
4933405O20Rik G A 7: 50,600,090 V291I probably damaging Het
A2ml1 A G 6: 128,581,122 Y24H probably damaging Het
Adgrv1 C T 13: 81,435,559 probably null Het
Ankrd52 C T 10: 128,382,697 H351Y probably damaging Het
Anks6 C A 4: 47,035,748 A588S probably benign Het
Arl15 T G 13: 113,934,109 V80G probably damaging Het
Atp8a1 A G 5: 67,747,285 I532T possibly damaging Het
Birc6 T C 17: 74,603,036 C1475R probably damaging Het
Carmil1 C T 13: 24,069,736 R394Q probably damaging Het
Cbfa2t2 T C 2: 154,517,777 I254T probably damaging Het
Col6a3 A G 1: 90,821,849 V421A possibly damaging Het
Cped1 T C 6: 22,254,608 V1000A probably damaging Het
Cr1l A T 1: 195,114,768 Y282* probably null Het
Cryl1 G T 14: 57,382,779 T43K probably benign Het
Csmd2 C T 4: 128,059,034 P92L probably damaging Het
Ddx60 G A 8: 62,021,410 probably null Het
Dhrs7b C T 11: 60,852,502 R187* probably null Het
Dmtf1 T C 5: 9,140,451 T88A probably damaging Het
Dnah2 T C 11: 69,520,881 E305G possibly damaging Het
Dscaml1 A C 9: 45,721,298 N1154T probably benign Het
Efhc1 A G 1: 20,960,218 Y125C probably damaging Het
Egflam T A 15: 7,318,245 Y68F possibly damaging Het
Gcm2 A G 13: 41,103,127 V382A probably damaging Het
Gm18358 A G 7: 85,090,548 noncoding transcript Het
Gm3443 T G 19: 21,557,596 I75S probably benign Het
Gpr182 C A 10: 127,750,879 V68F possibly damaging Het
Herc1 T A 9: 66,433,322 M1651K possibly damaging Het
Ighv1-43 A C 12: 114,946,209 V31G probably benign Het
Il17rc T C 6: 113,482,731 V450A probably damaging Het
Kbtbd4 T G 2: 90,906,143 V166G probably benign Het
Marveld2 T C 13: 100,611,689 N294S possibly damaging Het
Mtdh A G 15: 34,099,574 K61E probably damaging Het
Muc5ac T C 7: 141,796,367 S616P possibly damaging Het
Myh15 T C 16: 49,153,503 L1292P probably damaging Het
Nek8 C T 11: 78,167,825 V550M probably benign Het
Nup155 T A 15: 8,130,237 probably null Het
Olfr1356 A T 10: 78,847,738 M59K possibly damaging Het
Olfr1390 G A 11: 49,340,765 V78M probably damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Papln G A 12: 83,784,369 W1099* probably null Het
Pcdhb17 A G 18: 37,485,667 Y170C probably damaging Het
Pramef8 T C 4: 143,417,659 Y192H probably benign Het
Prss39 T G 1: 34,502,702 C287G probably damaging Het
Pyroxd2 A G 19: 42,735,472 V338A probably damaging Het
Rab19 T A 6: 39,383,926 F3I probably benign Het
Relt A G 7: 100,863,148 probably benign Het
Sbf2 T A 7: 110,377,986 H647L probably benign Het
Scube1 C T 15: 83,629,488 C327Y probably damaging Het
Sec14l4 A C 11: 4,040,055 Q118P possibly damaging Het
Shisa9 C G 16: 12,267,428 D300E probably benign Het
Smg1 A G 7: 118,141,357 probably benign Het
Sncaip A G 18: 52,869,321 T305A probably benign Het
Sorcs3 T C 19: 48,796,450 V1104A probably damaging Het
Tmem2 A G 19: 21,826,083 T827A probably benign Het
Ugt1a6b C T 1: 88,216,260 R201C probably damaging Het
Unc119b A G 5: 115,130,553 V91A probably benign Het
Uvssa A G 5: 33,389,860 K257E probably damaging Het
Vmn1r199 A C 13: 22,383,246 M237L probably benign Het
Vmn1r69 G A 7: 10,580,490 R26W probably damaging Het
Vmn2r54 A G 7: 12,632,216 F264L probably damaging Het
Vmn2r7 C T 3: 64,716,043 W285* probably null Het
Vmn2r78 T A 7: 86,920,333 S145T possibly damaging Het
Vmn2r78 T A 7: 86,954,907 N764K probably benign Het
Wdr5b T G 16: 36,042,004 H164Q probably damaging Het
Zcchc7 G A 4: 44,894,982 V236I possibly damaging Het
Zfp729b G A 13: 67,591,621 R842C probably benign Het
Other mutations in Hey1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02116:Hey1 APN 3 8666580 splice site probably null
IGL02486:Hey1 APN 3 8666519 missense probably damaging 1.00
IGL03265:Hey1 APN 3 8664914 missense probably benign 0.07
R1615:Hey1 UTSW 3 8664838 missense possibly damaging 0.47
R1969:Hey1 UTSW 3 8666819 missense probably benign 0.01
R1987:Hey1 UTSW 3 8664897 missense probably benign 0.16
R2419:Hey1 UTSW 3 8665943 critical splice donor site probably null
R3177:Hey1 UTSW 3 8664891 missense probably benign 0.10
R3277:Hey1 UTSW 3 8664891 missense probably benign 0.10
R3941:Hey1 UTSW 3 8664578 missense probably damaging 1.00
R4709:Hey1 UTSW 3 8665903 intron probably benign
R5988:Hey1 UTSW 3 8666319 missense probably damaging 1.00
X0019:Hey1 UTSW 3 8664867 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GGGAATTTGTGTAAGAACATCCAAC -3'
(R):5'- TGTGTTCCATGTCCCCAACG -3'

Sequencing Primer
(F):5'- GTGTAAGAACATCCAACGACTTGGC -3'
(R):5'- CTTCTCGTTGGAATGTACAG -3'
Posted On2017-06-27