Incidental Mutation 'R5978:Scel'
ID482134
Institutional Source Beutler Lab
Gene Symbol Scel
Ensembl Gene ENSMUSG00000022123
Gene Namesciellin
Synonyms9230114I02Rik
MMRRC Submission 044160-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5978 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location103513342-103612797 bp(+) (GRCm38)
Type of Mutationsplice site (10 bp from exon)
DNA Base Change (assembly) A to G at 103529254 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000154402 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095576] [ENSMUST00000227322]
Predicted Effect probably null
Transcript: ENSMUST00000095576
SMART Domains Protein: ENSMUSP00000093233
Gene: ENSMUSG00000022123

DomainStartEndE-ValueType
low complexity region 111 131 N/A INTRINSIC
low complexity region 159 178 N/A INTRINSIC
internal_repeat_1 204 327 9.24e-7 PROSPERO
internal_repeat_1 378 505 9.24e-7 PROSPERO
low complexity region 525 537 N/A INTRINSIC
LIM 584 642 2.23e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000227322
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a precursor to the cornified envelope of terminally differentiated keratinocytes. This protein localizes to the periphery of cells and may function in the assembly or regulation of proteins in the cornified envelope. Transcript variants encoding different isoforms exist. A transcript variant utilizing an alternative polyA signal has been described in the literature, but its full-length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are viable and fertile with normal hair morphology and development and normal skin morphology and barrier function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anks6 T A 4: 47,049,252 S218C probably damaging Het
Atp2c2 G A 8: 119,749,875 probably null Het
Ccdc146 T G 5: 21,316,968 I353L probably benign Het
Cst3 A T 2: 148,872,821 M112K probably benign Het
Cst3 T G 2: 148,872,822 M112L probably benign Het
Cyp2j11 A C 4: 96,319,352 L242R probably damaging Het
Eif5b T C 1: 37,998,280 probably null Het
Espl1 A G 15: 102,315,774 I1253M possibly damaging Het
Fstl5 C T 3: 76,145,085 H41Y probably damaging Het
Gm11011 T C 2: 169,584,441 K84R unknown Het
Hax1 GTCATCATCATCATCATC GTCATCATCATCATCATCATC 3: 89,997,940 probably benign Het
Heatr5b C A 17: 78,806,036 V923F probably damaging Het
Hnrnpll G A 17: 80,034,191 T473M probably damaging Het
Iars T A 13: 49,722,993 Y845N probably damaging Het
Il34 T A 8: 110,742,685 D166V probably damaging Het
Kel T A 6: 41,688,045 H595L probably benign Het
Krt77 T C 15: 101,862,928 I313M probably benign Het
Krt84 T C 15: 101,530,230 E274G probably damaging Het
Mctp2 T C 7: 72,090,188 Y818C probably damaging Het
Mrc1 A T 2: 14,315,393 Y1046F probably damaging Het
Myom1 A T 17: 71,117,443 D1429V probably damaging Het
Ncapg2 T C 12: 116,424,671 M325T possibly damaging Het
Nf1 T A 11: 79,540,419 I1902N probably damaging Het
Nkain3 A T 4: 20,485,026 probably null Het
Nlrc5 A T 8: 94,488,593 N940Y probably damaging Het
Nlrp9a T A 7: 26,557,278 I107K probably damaging Het
Ntn5 T C 7: 45,694,013 S328P possibly damaging Het
Olfr346 A C 2: 36,688,682 K227Q probably benign Het
Parp8 A C 13: 116,895,732 S302A probably benign Het
Ptgr2 G T 12: 84,295,258 E27* probably null Het
Rnf115 T A 3: 96,788,666 I256N probably damaging Het
Ryr3 T A 2: 112,672,269 H3515L probably benign Het
Slc4a5 T A 6: 83,277,536 S572T probably benign Het
Slc4a9 T G 18: 36,535,403 I705S probably damaging Het
Spint4 C T 2: 164,700,332 P101L probably damaging Het
Syt9 T A 7: 107,436,413 D212E probably benign Het
Tmem39a T A 16: 38,591,030 M449K probably benign Het
Ttn T C 2: 76,808,799 T13877A possibly damaging Het
Ube2v2 T C 16: 15,577,127 N20S probably benign Het
Vmn1r14 C T 6: 57,233,944 S169F probably benign Het
Vps13d T C 4: 145,122,611 H2410R probably benign Het
Wdr81 G A 11: 75,444,398 L1781F probably damaging Het
Zfp91 A G 19: 12,770,151 I536T probably benign Het
Other mutations in Scel
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00841:Scel APN 14 103529995 missense probably benign 0.01
IGL00913:Scel APN 14 103581809 missense probably benign 0.35
IGL01086:Scel APN 14 103612391 missense probably benign 0.05
IGL01352:Scel APN 14 103533338 missense possibly damaging 0.54
IGL01396:Scel APN 14 103608094 splice site probably benign
IGL01954:Scel APN 14 103603242 splice site probably benign
IGL02064:Scel APN 14 103533326 missense probably damaging 0.98
IGL02186:Scel APN 14 103564821 missense probably benign 0.23
IGL02475:Scel APN 14 103537008 missense possibly damaging 0.95
IGL02926:Scel APN 14 103576247 nonsense probably null
IGL03122:Scel APN 14 103599406 missense possibly damaging 0.66
IGL03135:Scel APN 14 103586514 missense probably benign 0.02
PIT4585001:Scel UTSW 14 103592368 missense possibly damaging 0.90
R0346:Scel UTSW 14 103529984 missense probably damaging 1.00
R0394:Scel UTSW 14 103562518 missense probably benign 0.15
R0418:Scel UTSW 14 103603254 missense probably benign
R0635:Scel UTSW 14 103583139 critical splice donor site probably null
R0815:Scel UTSW 14 103586480 missense possibly damaging 0.83
R0863:Scel UTSW 14 103586480 missense possibly damaging 0.83
R0990:Scel UTSW 14 103581832 missense possibly damaging 0.55
R1084:Scel UTSW 14 103564843 critical splice donor site probably null
R1641:Scel UTSW 14 103533316 missense probably damaging 1.00
R2001:Scel UTSW 14 103610790 missense possibly damaging 0.66
R2002:Scel UTSW 14 103541985 missense probably damaging 1.00
R2341:Scel UTSW 14 103608170 missense possibly damaging 0.92
R3425:Scel UTSW 14 103608106 missense possibly damaging 0.92
R3836:Scel UTSW 14 103592386 missense possibly damaging 0.66
R4035:Scel UTSW 14 103530004 missense probably damaging 1.00
R4197:Scel UTSW 14 103599400 missense probably damaging 0.97
R4737:Scel UTSW 14 103572037 missense possibly damaging 0.79
R4801:Scel UTSW 14 103583100 missense probably benign 0.01
R4802:Scel UTSW 14 103583100 missense probably benign 0.01
R5369:Scel UTSW 14 103586493 missense probably benign 0.00
R5555:Scel UTSW 14 103602206 missense probably benign 0.27
R5582:Scel UTSW 14 103583139 critical splice donor site probably benign
R5931:Scel UTSW 14 103605624 nonsense probably null
R6045:Scel UTSW 14 103592213 missense probably benign 0.12
R6062:Scel UTSW 14 103585136 missense possibly damaging 0.82
R6218:Scel UTSW 14 103572042 missense probably benign 0.12
R6225:Scel UTSW 14 103591984 missense probably benign 0.27
R7102:Scel UTSW 14 103543832 nonsense probably null
R7349:Scel UTSW 14 103543879 missense probably benign 0.11
R8376:Scel UTSW 14 103572015 missense probably benign 0.02
X0026:Scel UTSW 14 103591993 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- ACATCCTCAGGCTCTTGAAGG -3'
(R):5'- GGATGGTATATCTACATCATACACCC -3'

Sequencing Primer
(F):5'- AGGCACTTTATGTCACATTTGTG -3'
(R):5'- ATCTACATCATACACCCTTCCTCAC -3'
Posted On2017-06-27