Incidental Mutation 'R5983:Ide'
ID482143
Institutional Source Beutler Lab
Gene Symbol Ide
Ensembl Gene ENSMUSG00000056999
Gene Nameinsulin degrading enzyme
Synonyms
MMRRC Submission 044164-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5983 (G1)
Quality Score187.009
Status Validated
Chromosome19
Chromosomal Location37268743-37337852 bp(-) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) C to T at 37272150 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect probably null
Transcript: ENSMUST00000131070
SMART Domains Protein: ENSMUSP00000121358
Gene: ENSMUSG00000056999

DomainStartEndE-ValueType
Pfam:Peptidase_M16 42 180 8.1e-49 PFAM
Pfam:Peptidase_M16_C 205 385 2.1e-25 PFAM
Pfam:Peptidase_M16_M 389 671 1.9e-106 PFAM
Pfam:Peptidase_M16_C 674 857 9.4e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154339
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency 100% (29/29)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc metallopeptidase that degrades intracellular insulin, and thereby terminates insulins activity, as well as participating in intercellular peptide signalling by degrading diverse peptides such as glucagon, amylin, bradykinin, and kallidin. The preferential affinity of this enzyme for insulin results in insulin-mediated inhibition of the degradation of other peptides such as beta-amyloid. Deficiencies in this protein's function are associated with Alzheimer's disease and type 2 diabetes mellitus but mutations in this gene have not been shown to be causitive for these diseases. This protein localizes primarily to the cytoplasm but in some cell types localizes to the extracellular space, cell membrane, peroxisome, and mitochondrion. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Additional transcript variants have been described but have not been experimentally verified.[provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a disruption of this gene display beta amyloid accumulations in the brain, hyperinsulinemia and glucose intolerance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 T A 19: 43,819,503 M861K probably benign Het
Abhd18 T A 3: 40,910,544 F73L probably damaging Het
Abraxas1 A G 5: 100,807,911 V237A probably benign Het
Adam26b T C 8: 43,521,341 Y208C probably damaging Het
Aire A G 10: 78,043,069 L48P probably damaging Het
AU019823 A G 9: 50,607,842 S157P probably damaging Het
Bach2 A T 4: 32,563,324 E597V probably damaging Het
Ccdc170 A T 10: 4,520,851 R232* probably null Het
Cfap100 A C 6: 90,419,391 probably benign Het
D430042O09Rik T A 7: 125,850,373 W870R probably damaging Het
Dppa2 G A 16: 48,315,841 M185I probably benign Het
Ecsit C T 9: 22,078,147 probably null Het
Fbxw26 A G 9: 109,717,965 I464T possibly damaging Het
Grm8 T C 6: 27,760,221 K370R probably benign Het
Morn3 T C 5: 123,037,788 D179G possibly damaging Het
Nvl A T 1: 181,136,906 D102E probably benign Het
Olfr1436 T A 19: 12,299,103 I10F probably benign Het
Rbm5 G A 9: 107,744,942 P611L probably damaging Het
Rsph9 A G 17: 46,129,480 M230T probably benign Het
Sacs G A 14: 61,205,199 V1565M probably damaging Het
Serpina3n T C 12: 104,409,029 L120P probably damaging Het
Spsb2 A C 6: 124,809,748 E148A probably benign Het
Tmc2 T A 2: 130,247,976 M627K probably damaging Het
Tmem147 T C 7: 30,728,059 D111G probably damaging Het
Ttn A G 2: 76,742,381 V17729A possibly damaging Het
Vmn2r104 G A 17: 20,041,708 P387S probably damaging Het
Zfp940 C T 7: 29,845,052 V477M possibly damaging Het
Zw10 A G 9: 49,077,445 probably null Het
Other mutations in Ide
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Ide APN 19 37276532 missense unknown
IGL01924:Ide APN 19 37272164 missense unknown
IGL01925:Ide APN 19 37277897 missense unknown
IGL02616:Ide APN 19 37298056 missense unknown
R0738:Ide UTSW 19 37277965 nonsense probably null
R1509:Ide UTSW 19 37285204 critical splice donor site probably null
R1557:Ide UTSW 19 37280761 splice site probably null
R2935:Ide UTSW 19 37325307 missense unknown
R4260:Ide UTSW 19 37329186 missense unknown
R4261:Ide UTSW 19 37329186 missense unknown
R4575:Ide UTSW 19 37272205 missense unknown
R4913:Ide UTSW 19 37329070 missense unknown
R4933:Ide UTSW 19 37277756 missense unknown
R4951:Ide UTSW 19 37285232 missense unknown
R5102:Ide UTSW 19 37314984 missense unknown
R5474:Ide UTSW 19 37272184 missense unknown
R5502:Ide UTSW 19 37330456 missense unknown
R5546:Ide UTSW 19 37272224 missense unknown
R5601:Ide UTSW 19 37314980 missense unknown
R5696:Ide UTSW 19 37318021 missense unknown
R5884:Ide UTSW 19 37272153 critical splice donor site probably null
R6286:Ide UTSW 19 37278010 missense unknown
R7146:Ide UTSW 19 37295944 missense
R7224:Ide UTSW 19 37290761 missense
R7234:Ide UTSW 19 37290785 missense
R7695:Ide UTSW 19 37329036 missense
R7771:Ide UTSW 19 37298126 missense
R7811:Ide UTSW 19 37330511 missense
R7893:Ide UTSW 19 37284151 missense
R7976:Ide UTSW 19 37284151 missense
Z1176:Ide UTSW 19 37315491 missense
Predicted Primers PCR Primer
(F):5'- GGTTAGATCTGAGGCTCTGC -3'
(R):5'- GAAAGCTTCTATGGTGGCTGATTC -3'

Sequencing Primer
(F):5'- CCCTGCAGCTGCTTTTGGAG -3'
(R):5'- TTCTTCAGAGAGGCAGAGAGAAC -3'
Posted On2017-06-27