Incidental Mutation 'R5991:Tead3'
ID482152
Institutional Source Beutler Lab
Gene Symbol Tead3
Ensembl Gene ENSMUSG00000002249
Gene NameTEA domain family member 3
SynonymsDTEF-1, TEF-5, Tcf13r2, ETFR-1, TEAD-3
MMRRC Submission 044171-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5991 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location28331671-28350805 bp(-) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) A to T at 28334378 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152030 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042334] [ENSMUST00000114799] [ENSMUST00000129935] [ENSMUST00000154873] [ENSMUST00000156862] [ENSMUST00000156862] [ENSMUST00000219703]
Predicted Effect probably benign
Transcript: ENSMUST00000042334
SMART Domains Protein: ENSMUSP00000048469
Gene: ENSMUSG00000037805

DomainStartEndE-ValueType
Pfam:Ribosomal_L1 12 213 3.5e-49 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000080572
SMART Domains Protein: ENSMUSP00000079410
Gene: ENSMUSG00000002249

DomainStartEndE-ValueType
TEA 26 97 9.04e-52 SMART
low complexity region 124 139 N/A INTRINSIC
low complexity region 155 176 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
low complexity region 201 218 N/A INTRINSIC
PDB:3KYS|C 222 439 1e-121 PDB
Predicted Effect probably null
Transcript: ENSMUST00000114799
SMART Domains Protein: ENSMUSP00000110447
Gene: ENSMUSG00000002249

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
TEA 52 123 9.04e-52 SMART
low complexity region 150 165 N/A INTRINSIC
low complexity region 181 202 N/A INTRINSIC
low complexity region 208 222 N/A INTRINSIC
low complexity region 227 244 N/A INTRINSIC
PDB:3KYS|C 248 465 1e-120 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127212
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128758
Predicted Effect probably benign
Transcript: ENSMUST00000129935
SMART Domains Protein: ENSMUSP00000114141
Gene: ENSMUSG00000037805

DomainStartEndE-ValueType
Pfam:Ribosomal_L1 3 57 1.3e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141049
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143443
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146668
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150103
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151557
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152665
Predicted Effect probably null
Transcript: ENSMUST00000154873
SMART Domains Protein: ENSMUSP00000118582
Gene: ENSMUSG00000002249

DomainStartEndE-ValueType
Pfam:TEA 1 366 3.8e-149 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000156862
SMART Domains Protein: ENSMUSP00000115443
Gene: ENSMUSG00000002249

DomainStartEndE-ValueType
Pfam:TEA 1 366 3.8e-149 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000156862
SMART Domains Protein: ENSMUSP00000115443
Gene: ENSMUSG00000002249

DomainStartEndE-ValueType
Pfam:TEA 1 366 3.8e-149 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000219703
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226172
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.0%
  • 20x: 90.5%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: This gene product is a member of the transcriptional enhancer factor (TEF) family of transcription factors, which contain the TEA/ATTS DNA-binding domain. It is predominantly expressed in the placenta and thought to play a role in placental gene regulation and development. Alternative splicing, and alternate use of an upstream AUG translation initiation codon, and an in-frame downstream non-AUG (AUA) codon, results in 2 isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars G A 8: 111,050,400 R683Q probably damaging Het
Adam8 T A 7: 139,990,287 H69L probably damaging Het
Bbs2 G T 8: 94,098,286 R23S probably benign Het
Bod1l A T 5: 41,816,863 C2369* probably null Het
Capn11 G T 17: 45,659,352 probably null Het
Carmil2 A G 8: 105,691,391 Q679R probably null Het
Cep120 T C 18: 53,721,798 I422V probably benign Het
Cnot7 A C 8: 40,495,655 probably null Het
Col1a1 T C 11: 94,937,919 V29A unknown Het
Dnttip1 A T 2: 164,754,180 Q115L possibly damaging Het
Dyrk4 A G 6: 126,880,225 V497A probably benign Het
Ep300 A G 15: 81,648,466 D1635G unknown Het
Ercc5 T A 1: 44,180,830 C1087* probably null Het
Fap A T 2: 62,518,521 M517K probably damaging Het
Focad C A 4: 88,401,019 D1574E possibly damaging Het
Fsip2 C T 2: 82,990,468 P5515L probably benign Het
Gm9733 G T 3: 15,320,758 A28E probably benign Het
Gpr158 T C 2: 21,368,508 Y85H probably damaging Het
Hc A G 2: 35,006,105 V1222A possibly damaging Het
Hipk3 C T 2: 104,437,983 M546I probably damaging Het
Jup T C 11: 100,379,569 N371D possibly damaging Het
Ltbp4 A G 7: 27,309,316 Y1262H probably damaging Het
Lyar A G 5: 38,227,865 E83G probably damaging Het
Lyg2 C T 1: 37,915,719 probably null Het
Mtmr11 T A 3: 96,168,589 probably null Het
Myct1 A T 10: 5,604,426 R98* probably null Het
Nol11 T C 11: 107,171,145 T612A probably benign Het
Olfr1034 A G 2: 86,046,910 I143V probably benign Het
Olfr1218 C T 2: 89,054,782 V215I probably benign Het
Olfr1314 C T 2: 112,092,615 V29M probably benign Het
Olfr167 T C 16: 19,514,757 N293S probably damaging Het
Olfr32 T A 2: 90,138,234 K302* probably null Het
Parp14 G A 16: 35,841,457 P1403S probably benign Het
Pcdhb3 T C 18: 37,301,508 S176P probably benign Het
Pdcd1lg2 C T 19: 29,454,467 R212W probably benign Het
Plin3 T C 17: 56,286,576 Y46C probably damaging Het
Rfx7 G A 9: 72,619,538 E1337K possibly damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Ryr1 G T 7: 29,104,610 N584K probably damaging Het
Scmh1 T C 4: 120,522,620 V544A probably benign Het
Sdk2 G A 11: 113,943,254 T34M probably damaging Het
Serpinb9e T A 13: 33,259,807 L270H probably damaging Het
Shoc2 T A 19: 54,003,049 N248K probably damaging Het
Slc25a4 T C 8: 46,209,336 Y95C probably damaging Het
Slc4a1ap A G 5: 31,534,069 N403S possibly damaging Het
Spink10 T A 18: 62,657,885 W7R probably null Het
Ssrp1 A G 2: 85,042,296 K426R possibly damaging Het
Tbc1d24 G A 17: 24,209,069 probably benign Het
Timd4 A G 11: 46,843,203 *344W probably null Het
Tmem181a T A 17: 6,289,037 W115R probably damaging Het
Tmem245 G A 4: 56,916,733 T65I probably damaging Het
Vmn1r12 G C 6: 57,159,655 V202L probably damaging Het
Vmn1r80 A G 7: 12,193,496 T178A probably benign Het
Vps33b T A 7: 80,283,414 probably null Het
Zmym6 T A 4: 127,108,473 probably null Het
Other mutations in Tead3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Tead3 APN 17 28332806 missense possibly damaging 0.91
IGL01752:Tead3 APN 17 28333594 missense probably damaging 1.00
IGL01760:Tead3 APN 17 28333081 missense probably benign 0.07
IGL02868:Tead3 APN 17 28333095 nonsense probably null
IGL02932:Tead3 APN 17 28341351 missense probably damaging 1.00
R0015:Tead3 UTSW 17 28341351 missense probably damaging 1.00
R0376:Tead3 UTSW 17 28341365 missense probably damaging 0.98
R0383:Tead3 UTSW 17 28334698 splice site probably null
R1203:Tead3 UTSW 17 28341562 missense probably benign 0.06
R1699:Tead3 UTSW 17 28334724 missense possibly damaging 0.52
R2037:Tead3 UTSW 17 28336570 missense probably damaging 0.98
R2148:Tead3 UTSW 17 28333664 missense probably damaging 1.00
R4871:Tead3 UTSW 17 28333615 missense probably damaging 1.00
R4871:Tead3 UTSW 17 28334988 missense probably benign 0.42
R5070:Tead3 UTSW 17 28341477 missense probably benign 0.06
R5557:Tead3 UTSW 17 28336270 intron probably benign
R5891:Tead3 UTSW 17 28341365 missense probably damaging 0.98
R6335:Tead3 UTSW 17 28333325 missense probably damaging 1.00
R6999:Tead3 UTSW 17 28341532 missense probably benign 0.00
R7165:Tead3 UTSW 17 28333254 missense probably benign 0.00
R7718:Tead3 UTSW 17 28333517 missense probably damaging 1.00
R7743:Tead3 UTSW 17 28332827 missense probably benign 0.06
R8025:Tead3 UTSW 17 28335035 missense not run
R8034:Tead3 UTSW 17 28333229 missense not run
X0066:Tead3 UTSW 17 28341427 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAAGGAGGTAATCTTGGTAGTAG -3'
(R):5'- TCGGAGTTAAACTGCAAAGGTG -3'

Sequencing Primer
(F):5'- AGGTAATCTTGGTAGTAGTCATGAG -3'
(R):5'- CAAAGGTGGAGGGCTAGCTTG -3'
Posted On2017-06-27