Incidental Mutation 'R5991:Capn11'
ID482153
Institutional Source Beutler Lab
Gene Symbol Capn11
Ensembl Gene ENSMUSG00000058626
Gene Namecalpain 11
Synonyms
MMRRC Submission 044171-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5991 (G1)
Quality Score115.008
Status Validated
Chromosome17
Chromosomal Location45630204-45659325 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to T at 45659352 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000113132 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113523] [ENSMUST00000120717] [ENSMUST00000151350]
Predicted Effect probably benign
Transcript: ENSMUST00000113523
SMART Domains Protein: ENSMUSP00000109151
Gene: ENSMUSG00000036026

DomainStartEndE-ValueType
transmembrane domain 40 62 N/A INTRINSIC
low complexity region 82 92 N/A INTRINSIC
Pfam:RSN1_TM 101 226 2.5e-23 PFAM
Pfam:PHM7_cyt 274 344 9.1e-10 PFAM
Pfam:RSN1_7TM 362 706 5.3e-96 PFAM
transmembrane domain 711 733 N/A INTRINSIC
low complexity region 778 805 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000120717
SMART Domains Protein: ENSMUSP00000113132
Gene: ENSMUSG00000058626

DomainStartEndE-ValueType
CysPc 37 362 2.75e-157 SMART
calpain_III 366 523 2.57e-84 SMART
EFh 590 618 3.91e-4 SMART
EFh 620 648 6.88e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129177
Predicted Effect probably benign
Transcript: ENSMUST00000151350
SMART Domains Protein: ENSMUSP00000119679
Gene: ENSMUSG00000058626

DomainStartEndE-ValueType
Pfam:Peptidase_C2 94 153 1.5e-14 PFAM
low complexity region 163 174 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151439
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156224
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.0%
  • 20x: 90.5%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Calpains constitute a family of intracellular calcium-dependent cysteine proteases. There are eight members in this superfamily. They consist of a variable 80 kDa subunit and an invariant 30 kDa subunit. This calpain protein appears to have protease activity and calcium-binding ability. A similar mouse protein may play a functional role in spermatogenesis and in the regulation of calcium-dependent signal transduction events during meiosis. [provided by RefSeq, Dec 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars G A 8: 111,050,400 R683Q probably damaging Het
Adam8 T A 7: 139,990,287 H69L probably damaging Het
Bbs2 G T 8: 94,098,286 R23S probably benign Het
Bod1l A T 5: 41,816,863 C2369* probably null Het
Carmil2 A G 8: 105,691,391 Q679R probably null Het
Cep120 T C 18: 53,721,798 I422V probably benign Het
Cnot7 A C 8: 40,495,655 probably null Het
Col1a1 T C 11: 94,937,919 V29A unknown Het
Dnttip1 A T 2: 164,754,180 Q115L possibly damaging Het
Dyrk4 A G 6: 126,880,225 V497A probably benign Het
Ep300 A G 15: 81,648,466 D1635G unknown Het
Ercc5 T A 1: 44,180,830 C1087* probably null Het
Fap A T 2: 62,518,521 M517K probably damaging Het
Focad C A 4: 88,401,019 D1574E possibly damaging Het
Fsip2 C T 2: 82,990,468 P5515L probably benign Het
Gm9733 G T 3: 15,320,758 A28E probably benign Het
Gpr158 T C 2: 21,368,508 Y85H probably damaging Het
Hc A G 2: 35,006,105 V1222A possibly damaging Het
Hipk3 C T 2: 104,437,983 M546I probably damaging Het
Jup T C 11: 100,379,569 N371D possibly damaging Het
Ltbp4 A G 7: 27,309,316 Y1262H probably damaging Het
Lyar A G 5: 38,227,865 E83G probably damaging Het
Lyg2 C T 1: 37,915,719 probably null Het
Mtmr11 T A 3: 96,168,589 probably null Het
Myct1 A T 10: 5,604,426 R98* probably null Het
Nol11 T C 11: 107,171,145 T612A probably benign Het
Olfr1034 A G 2: 86,046,910 I143V probably benign Het
Olfr1218 C T 2: 89,054,782 V215I probably benign Het
Olfr1314 C T 2: 112,092,615 V29M probably benign Het
Olfr167 T C 16: 19,514,757 N293S probably damaging Het
Olfr32 T A 2: 90,138,234 K302* probably null Het
Parp14 G A 16: 35,841,457 P1403S probably benign Het
Pcdhb3 T C 18: 37,301,508 S176P probably benign Het
Pdcd1lg2 C T 19: 29,454,467 R212W probably benign Het
Plin3 T C 17: 56,286,576 Y46C probably damaging Het
Rfx7 G A 9: 72,619,538 E1337K possibly damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Ryr1 G T 7: 29,104,610 N584K probably damaging Het
Scmh1 T C 4: 120,522,620 V544A probably benign Het
Sdk2 G A 11: 113,943,254 T34M probably damaging Het
Serpinb9e T A 13: 33,259,807 L270H probably damaging Het
Shoc2 T A 19: 54,003,049 N248K probably damaging Het
Slc25a4 T C 8: 46,209,336 Y95C probably damaging Het
Slc4a1ap A G 5: 31,534,069 N403S possibly damaging Het
Spink10 T A 18: 62,657,885 W7R probably null Het
Ssrp1 A G 2: 85,042,296 K426R possibly damaging Het
Tbc1d24 G A 17: 24,209,069 probably benign Het
Tead3 A T 17: 28,334,378 probably null Het
Timd4 A G 11: 46,843,203 *344W probably null Het
Tmem181a T A 17: 6,289,037 W115R probably damaging Het
Tmem245 G A 4: 56,916,733 T65I probably damaging Het
Vmn1r12 G C 6: 57,159,655 V202L probably damaging Het
Vmn1r80 A G 7: 12,193,496 T178A probably benign Het
Vps33b T A 7: 80,283,414 probably null Het
Zmym6 T A 4: 127,108,473 probably null Het
Other mutations in Capn11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Capn11 APN 17 45643767 missense probably damaging 1.00
IGL01116:Capn11 APN 17 45638880 unclassified probably benign
IGL01121:Capn11 APN 17 45639132 missense probably benign 0.04
IGL01366:Capn11 APN 17 45653200 missense probably damaging 1.00
IGL01533:Capn11 APN 17 45632904 missense probably benign
IGL01595:Capn11 APN 17 45639434 missense probably benign 0.02
IGL02197:Capn11 APN 17 45639856 missense probably benign 0.14
IGL02683:Capn11 APN 17 45653591 missense probably damaging 1.00
IGL02696:Capn11 APN 17 45632709 missense probably damaging 1.00
IGL02711:Capn11 APN 17 45632415 missense probably damaging 1.00
IGL02900:Capn11 APN 17 45630614 splice site probably null
IGL03033:Capn11 APN 17 45642547 missense probably damaging 1.00
R0883:Capn11 UTSW 17 45638881 unclassified probably benign
R1494:Capn11 UTSW 17 45643809 missense probably damaging 1.00
R1735:Capn11 UTSW 17 45632401 nonsense probably null
R1785:Capn11 UTSW 17 45638697 missense probably benign 0.02
R1952:Capn11 UTSW 17 45642959 missense probably damaging 1.00
R2149:Capn11 UTSW 17 45633107 critical splice acceptor site probably null
R2397:Capn11 UTSW 17 45653221 missense probably damaging 1.00
R2495:Capn11 UTSW 17 45638763 missense probably damaging 0.97
R2516:Capn11 UTSW 17 45633799 missense probably damaging 0.98
R3934:Capn11 UTSW 17 45634287 splice site probably benign
R4016:Capn11 UTSW 17 45653756 missense probably damaging 1.00
R4226:Capn11 UTSW 17 45642466 critical splice donor site probably null
R4227:Capn11 UTSW 17 45642466 critical splice donor site probably null
R4774:Capn11 UTSW 17 45633080 missense probably benign 0.00
R4892:Capn11 UTSW 17 45633097 frame shift probably null
R5244:Capn11 UTSW 17 45633892 missense probably damaging 1.00
R5667:Capn11 UTSW 17 45639674 missense possibly damaging 0.87
R5671:Capn11 UTSW 17 45639674 missense possibly damaging 0.87
R6180:Capn11 UTSW 17 45630766 missense probably damaging 1.00
R6193:Capn11 UTSW 17 45653504 critical splice donor site probably null
R6774:Capn11 UTSW 17 45657330 intron probably benign
R7047:Capn11 UTSW 17 45638696 nonsense probably null
R7302:Capn11 UTSW 17 45643812 missense probably damaging 1.00
R7516:Capn11 UTSW 17 45638840 missense possibly damaging 0.95
R7563:Capn11 UTSW 17 45633965 missense probably damaging 0.99
R7718:Capn11 UTSW 17 45643781 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGTCTGATAAGAGAGACCCC -3'
(R):5'- TTGAAAGGGAGGGACTTGCC -3'

Sequencing Primer
(F):5'- ACCCCAGTCTGAGGCCTC -3'
(R):5'- GTTGGGTGCTTGTCCCCC -3'
Posted On2017-06-27