Incidental Mutation 'R4958:Hsf2'
ID482158
Institutional Source Beutler Lab
Gene Symbol Hsf2
Ensembl Gene ENSMUSG00000019878
Gene Nameheat shock factor 2
Synonyms
MMRRC Submission 042555-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4958 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location57486385-57513135 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 57501371 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 121 (I121T)
Ref Sequence ENSEMBL: ENSMUSP00000152013 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079833] [ENSMUST00000220042] [ENSMUST00000220353]
Predicted Effect probably damaging
Transcript: ENSMUST00000079833
AA Change: I178T

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000078761
Gene: ENSMUSG00000019878
AA Change: I178T

DomainStartEndE-ValueType
HSF 6 110 1.99e-62 SMART
coiled coil region 133 176 N/A INTRINSIC
Pfam:Vert_HS_TF 230 392 1.5e-39 PFAM
Pfam:Vert_HS_TF 391 494 2.2e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218251
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219171
Predicted Effect probably damaging
Transcript: ENSMUST00000220042
AA Change: I121T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000220353
AA Change: I178T

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the HSF family of transcription factors that bind specifically to the heat-shock promoter element and activate transcription. Heat shock transcription factors activate heat-shock response genes under conditions of heat or other stresses. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2011]
PHENOTYPE: Homozygotes for targeted null mutations exhibit increased late-gestational lethality associated with collapsed lateral ventricles and ventricular bleeding. Survivors may show ventricular dilation, sterility in females, and reduced sperm counts in males. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd7 A G 6: 18,866,723 S81G probably benign Het
Arel1 T C 12: 84,926,304 K573R possibly damaging Het
Atf7ip C T 6: 136,606,810 R1280C probably damaging Het
Atp1a4 T A 1: 172,231,151 D909V probably damaging Het
Cdh2 T G 18: 16,627,565 probably null Het
Col6a1 A T 10: 76,723,505 I99N probably damaging Het
Dennd4c A G 4: 86,781,679 T256A probably damaging Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Ereg T C 5: 91,090,111 V152A probably damaging Het
Gm4950 T C 18: 51,865,569 T105A probably benign Het
Kmt2a A T 9: 44,848,467 L728Q probably damaging Het
Llgl1 G T 11: 60,711,435 R768L probably benign Het
Lyst A G 13: 13,635,463 I573V probably benign Het
Macf1 G T 4: 123,475,364 T303K probably damaging Het
Map3k5 A T 10: 20,023,789 Q264L possibly damaging Het
Mboat1 T C 13: 30,224,393 S180P probably damaging Het
Mfsd6 T C 1: 52,661,024 D655G probably damaging Het
Myh2 A G 11: 67,192,959 E1521G possibly damaging Het
Nsd2 T A 5: 33,892,022 S1200R probably damaging Het
Olfr1099 T C 2: 86,959,105 M118V possibly damaging Het
Olfr1336 G A 7: 6,461,058 C183Y probably damaging Het
Olfr633 T C 7: 103,946,601 F12L probably damaging Het
Olfr667 T C 7: 104,916,461 I278M probably damaging Het
Pbrm1 T C 14: 31,074,827 I875T probably damaging Het
Pla2g1b T A 5: 115,470,826 F26I probably damaging Het
Plscr4 A G 9: 92,484,761 N143D possibly damaging Het
Rab11fip1 G T 8: 27,154,813 R315S probably damaging Het
Rptor G A 11: 119,857,391 R727Q probably benign Het
Serac1 A T 17: 6,069,382 V91D probably benign Het
Slco1a6 C A 6: 142,145,705 G90C probably damaging Het
Sulf1 A G 1: 12,796,910 Y106C probably benign Het
Syt13 G A 2: 92,953,449 V355M probably damaging Het
Tjp1 G A 7: 65,336,102 R314* probably null Het
Tshr A G 12: 91,538,187 D633G probably damaging Het
Usp5 C G 6: 124,822,630 K318N possibly damaging Het
Znrf4 A G 17: 56,511,701 F202S probably damaging Het
Zswim8 T A 14: 20,713,465 W427R probably damaging Het
Other mutations in Hsf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Hsf2 APN 10 57512028 missense probably benign 0.00
IGL00965:Hsf2 APN 10 57512100 missense probably damaging 1.00
IGL01338:Hsf2 APN 10 57501379 missense probably damaging 1.00
IGL01518:Hsf2 APN 10 57512134 missense probably damaging 1.00
IGL01721:Hsf2 APN 10 57496181 missense probably benign 0.13
IGL02219:Hsf2 APN 10 57496274 missense probably damaging 1.00
IGL03493:Hsf2 APN 10 57505366 missense probably damaging 1.00
R0270:Hsf2 UTSW 10 57502639 missense probably benign 0.28
R1774:Hsf2 UTSW 10 57512146 missense probably damaging 1.00
R2406:Hsf2 UTSW 10 57497546 missense probably damaging 0.96
R3410:Hsf2 UTSW 10 57505282 missense probably damaging 1.00
R4829:Hsf2 UTSW 10 57496170 missense probably damaging 0.96
R5154:Hsf2 UTSW 10 57504712 missense probably benign
R5237:Hsf2 UTSW 10 57506221 missense probably benign 0.16
R5903:Hsf2 UTSW 10 57504723 missense probably benign
R6125:Hsf2 UTSW 10 57512005 missense probably benign
R6126:Hsf2 UTSW 10 57495917 missense probably damaging 1.00
R6280:Hsf2 UTSW 10 57511495 missense probably benign 0.03
R6309:Hsf2 UTSW 10 57486580 start gained probably benign
R6954:Hsf2 UTSW 10 57504643 missense probably damaging 1.00
R6966:Hsf2 UTSW 10 57495984 missense probably damaging 1.00
R7088:Hsf2 UTSW 10 57512092 missense probably damaging 1.00
R7182:Hsf2 UTSW 10 57505176 missense possibly damaging 0.87
R7511:Hsf2 UTSW 10 57504557 missense probably benign 0.00
R7743:Hsf2 UTSW 10 57511335 intron probably null
Z1088:Hsf2 UTSW 10 57496168 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACAGTGCTGTCTTCCTGG -3'
(R):5'- GATCCTCACCCTGTTAAGACTATTC -3'

Sequencing Primer
(F):5'- CAGTGCTGTCTTCCTGGAAAAAC -3'
(R):5'- CCCTGTTAAGACTATTCTTGAAATGC -3'
Posted On2017-06-29