Incidental Mutation 'R4942:Emid1'
ID482180
Institutional Source Beutler Lab
Gene Symbol Emid1
Ensembl Gene ENSMUSG00000034164
Gene NameEMI domain containing 1
SynonymsCO-5, Emu1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R4942 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location5106265-5152257 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 5129430 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 323 (M323L)
Ref Sequence ENSEMBL: ENSMUSP00000061704 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062821] [ENSMUST00000156492] [ENSMUST00000163299]
Predicted Effect probably benign
Transcript: ENSMUST00000062821
AA Change: M323L

PolyPhen 2 Score 0.163 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000061704
Gene: ENSMUSG00000034164
AA Change: M323L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:EMI 34 101 8.7e-18 PFAM
low complexity region 200 211 N/A INTRINSIC
low complexity region 220 267 N/A INTRINSIC
Pfam:Collagen 282 342 5e-10 PFAM
Pfam:Collagen 312 377 4.2e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132196
Predicted Effect unknown
Transcript: ENSMUST00000132328
AA Change: M99L
SMART Domains Protein: ENSMUSP00000117779
Gene: ENSMUSG00000034164
AA Change: M99L

DomainStartEndE-ValueType
low complexity region 1 44 N/A INTRINSIC
Pfam:Collagen 59 113 4.5e-10 PFAM
Pfam:Collagen 89 152 2e-13 PFAM
low complexity region 154 169 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000151906
AA Change: M17L
SMART Domains Protein: ENSMUSP00000124014
Gene: ENSMUSG00000034164
AA Change: M17L

DomainStartEndE-ValueType
Pfam:Collagen 2 68 8.4e-14 PFAM
low complexity region 72 87 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153308
SMART Domains Protein: ENSMUSP00000125605
Gene: ENSMUSG00000034164

DomainStartEndE-ValueType
Pfam:Collagen 1 49 1.6e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156492
SMART Domains Protein: ENSMUSP00000124431
Gene: ENSMUSG00000034164

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:EMI 33 103 3.5e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163299
AA Change: M321L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000131391
Gene: ENSMUSG00000034164
AA Change: M321L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:EMI 33 101 7.3e-24 PFAM
low complexity region 198 209 N/A INTRINSIC
low complexity region 218 265 N/A INTRINSIC
Pfam:Collagen 280 340 5.1e-10 PFAM
Pfam:Collagen 310 375 4.3e-12 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930539E08Rik T C 17: 28,903,258 R420G probably benign Het
5730522E02Rik A G 11: 25,770,472 probably null Het
Adamts7 T C 9: 90,163,311 S23P probably benign Het
Adamtsl1 T A 4: 86,341,214 C824* probably null Het
Adgre1 A G 17: 57,406,903 Y196C probably damaging Het
Arap1 A G 7: 101,401,802 D542G possibly damaging Het
B3gat1 A G 9: 26,755,598 D42G probably benign Het
Birc6 G A 17: 74,623,050 A2412T probably damaging Het
Bsn A G 9: 108,106,479 Y3459H unknown Het
Cacnb1 T C 11: 98,002,983 Y571C probably damaging Het
Cdk2ap2 G A 19: 4,097,508 probably null Het
Cep57 A G 9: 13,813,427 S265P probably damaging Het
Clca1 A G 3: 145,004,763 I893T probably benign Het
Clca3a2 T A 3: 144,806,502 E491V probably damaging Het
Cldn10 G A 14: 118,788,313 G53S possibly damaging Het
Cobl A T 11: 12,254,185 I832N probably damaging Het
Col9a2 T C 4: 121,053,119 V487A possibly damaging Het
Cse1l C T 2: 166,929,794 T325I probably damaging Het
Dlx6 A G 6: 6,863,468 Q30R probably benign Het
Dnah8 T C 17: 30,729,142 V1902A probably benign Het
Dusp8 A G 7: 142,082,228 F542L possibly damaging Het
Ercc5 A G 1: 44,175,965 D886G probably benign Het
Fam184b T C 5: 45,573,307 E461G probably damaging Het
Fbn1 C A 2: 125,383,616 C572F possibly damaging Het
Gigyf1 G T 5: 137,525,690 V1041L possibly damaging Het
Grin3b A G 10: 79,975,722 H714R probably damaging Het
Heatr1 A G 13: 12,413,510 probably null Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Llgl1 C T 11: 60,709,568 P581L probably benign Het
Lypd6b C A 2: 49,946,120 H104Q probably benign Het
Man1a A T 10: 53,933,490 probably null Het
Megf6 A T 4: 154,253,820 D449V probably damaging Het
Mtor T C 4: 148,472,142 V1003A probably benign Het
Ncan C A 8: 70,100,294 W1096L probably damaging Het
Ndor1 C T 2: 25,248,121 probably null Het
Ndufaf1 T C 2: 119,660,066 E171G possibly damaging Het
Nell1 T C 7: 50,120,649 V152A possibly damaging Het
Nt5dc1 A T 10: 34,322,677 V255E probably damaging Het
Olfr10 A T 11: 49,317,548 M1L probably null Het
Olfr434 T A 6: 43,216,994 F27Y probably damaging Het
Olfr619 G A 7: 103,604,194 R180H probably benign Het
Olfr652 A G 7: 104,565,005 I261M probably benign Het
Otud7a T C 7: 63,757,423 I50T probably damaging Het
P2ry13 G A 3: 59,209,562 T265I probably benign Het
Pde4d A G 13: 108,860,199 S12G probably benign Het
Pdzd3 C A 9: 44,248,618 G402* probably null Het
Pigk C A 3: 152,744,517 N219K probably damaging Het
Plcg1 T A 2: 160,753,589 probably null Het
Psd2 A T 18: 35,978,664 D114V probably damaging Het
Ptch1 A T 13: 63,525,070 I770N probably benign Het
Ptprq A T 10: 107,688,429 M481K probably benign Het
Rnf216 A C 5: 143,093,059 M45R probably damaging Het
Rpsa T A 9: 120,131,063 W231R probably benign Het
Ryr1 G T 7: 29,069,573 T2797N probably damaging Het
Ryr3 A T 2: 112,836,257 M1468K probably damaging Het
Slc6a7 A G 18: 61,004,517 Y244H probably damaging Het
Slco6c1 T A 1: 97,081,324 D462V probably damaging Het
Spata31d1b A T 13: 59,717,103 E688D possibly damaging Het
Srpr G A 9: 35,215,470 R508H probably benign Het
Tnrc18 A T 5: 142,787,982 I181N unknown Het
Tnrc6a T C 7: 123,192,613 F1785L probably damaging Het
Trio A T 15: 27,752,725 D2174E probably benign Het
Ttn C T 2: 76,793,256 V15326I probably damaging Het
Ubap2 T A 4: 41,245,461 probably benign Het
Vmn2r113 C T 17: 22,958,347 P702S probably damaging Het
Vmn2r66 A T 7: 85,007,772 W142R probably damaging Het
Vmn2r73 A G 7: 85,870,374 Y459H probably damaging Het
Wsb2 C T 5: 117,377,485 T385M probably damaging Het
Other mutations in Emid1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01319:Emid1 APN 11 5143859 missense probably damaging 1.00
R0024:Emid1 UTSW 11 5143869 missense probably damaging 1.00
R0063:Emid1 UTSW 11 5139704 intron probably benign
R0684:Emid1 UTSW 11 5143866 missense probably damaging 1.00
R2209:Emid1 UTSW 11 5135407 missense probably benign 0.01
R2266:Emid1 UTSW 11 5144331 missense probably damaging 0.97
R4913:Emid1 UTSW 11 5132012 missense probably benign 0.16
R4993:Emid1 UTSW 11 5131512 missense probably benign 0.04
R6010:Emid1 UTSW 11 5135389 missense possibly damaging 0.55
RF043:Emid1 UTSW 11 5144322 missense probably damaging 1.00
T0975:Emid1 UTSW 11 5128884 missense probably benign 0.35
T0975:Emid1 UTSW 11 5144386 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGTTAAAGAGGTCTGGAGTC -3'
(R):5'- CATGGGTAAGTTGAGTCCAGG -3'

Sequencing Primer
(F):5'- TGGAGTCAGATGTCCTCACC -3'
(R):5'- AAGTTGAGTCCAGGTGGGG -3'
Posted On2017-06-29