Incidental Mutation 'R5443:Ppig'
ID482211
Institutional Source Beutler Lab
Gene Symbol Ppig
Ensembl Gene ENSMUSG00000042133
Gene Namepeptidyl-prolyl isomerase G (cyclophilin G)
SynonymsSRCyp, B230312B02Rik
MMRRC Submission 043008-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.797) question?
Stock #R5443 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location69722545-69754012 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 69734291 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 97 (D97V)
Ref Sequence ENSEMBL: ENSMUSP00000114570 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040915] [ENSMUST00000090858] [ENSMUST00000144652]
Predicted Effect probably damaging
Transcript: ENSMUST00000040915
AA Change: D97V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045945
Gene: ENSMUSG00000042133
AA Change: D97V

DomainStartEndE-ValueType
Pfam:Pro_isomerase 11 176 2.8e-50 PFAM
low complexity region 180 258 N/A INTRINSIC
low complexity region 272 280 N/A INTRINSIC
low complexity region 295 307 N/A INTRINSIC
low complexity region 334 354 N/A INTRINSIC
low complexity region 417 433 N/A INTRINSIC
low complexity region 441 478 N/A INTRINSIC
internal_repeat_1 483 518 1.1e-9 PROSPERO
internal_repeat_2 485 555 1.1e-9 PROSPERO
internal_repeat_3 506 556 4.26e-7 PROSPERO
internal_repeat_1 521 556 1.1e-9 PROSPERO
low complexity region 559 586 N/A INTRINSIC
low complexity region 591 637 N/A INTRINSIC
internal_repeat_3 646 693 4.26e-7 PROSPERO
internal_repeat_4 653 686 6.68e-6 PROSPERO
internal_repeat_2 661 735 1.1e-9 PROSPERO
internal_repeat_4 711 744 6.68e-6 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000090858
AA Change: D97V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000088370
Gene: ENSMUSG00000042133
AA Change: D97V

DomainStartEndE-ValueType
Pfam:Pro_isomerase 11 176 2.7e-49 PFAM
low complexity region 180 258 N/A INTRINSIC
low complexity region 272 280 N/A INTRINSIC
low complexity region 295 307 N/A INTRINSIC
low complexity region 334 354 N/A INTRINSIC
low complexity region 417 433 N/A INTRINSIC
low complexity region 441 478 N/A INTRINSIC
internal_repeat_1 483 518 1.1e-9 PROSPERO
internal_repeat_2 485 555 1.1e-9 PROSPERO
internal_repeat_3 506 556 4.26e-7 PROSPERO
internal_repeat_1 521 556 1.1e-9 PROSPERO
low complexity region 559 586 N/A INTRINSIC
low complexity region 591 637 N/A INTRINSIC
internal_repeat_3 646 693 4.26e-7 PROSPERO
internal_repeat_4 653 686 6.68e-6 PROSPERO
internal_repeat_2 661 735 1.1e-9 PROSPERO
internal_repeat_4 711 744 6.68e-6 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120658
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124810
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125105
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128506
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134424
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134500
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142839
Predicted Effect probably damaging
Transcript: ENSMUST00000144652
AA Change: D97V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114570
Gene: ENSMUSG00000042133
AA Change: D97V

DomainStartEndE-ValueType
Pfam:Pro_isomerase 11 127 8.4e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146234
Meta Mutation Damage Score 0.9727 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.9%
Validation Efficiency 99% (68/69)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110004E09Rik G T 16: 90,927,211 Q168K probably benign Het
Akap12 A T 10: 4,355,576 E795D probably damaging Het
Aldh6a1 T C 12: 84,437,971 probably null Het
Aox4 A G 1: 58,233,992 probably null Het
Arhgap39 G A 15: 76,797,925 probably benign Het
AW551984 T C 9: 39,598,029 E272G possibly damaging Het
C1qc G A 4: 136,892,493 probably benign Het
Carhsp1 C A 16: 8,664,339 R26L probably benign Het
Cdh12 G T 15: 21,237,849 V57L probably benign Het
Clec3a A G 8: 114,418,153 Y23C probably benign Het
Crebrf G C 17: 26,742,354 V150L probably damaging Het
Ddx41 G T 13: 55,535,291 A201E probably benign Het
Doc2b T C 11: 75,780,095 K237E probably damaging Het
Dst T C 1: 34,228,539 S5199P probably damaging Het
Efnb2 A G 8: 8,620,862 I129T probably damaging Het
Epg5 A G 18: 78,027,497 E2329G possibly damaging Het
Esrrg A C 1: 188,043,425 T27P possibly damaging Het
Fah T A 7: 84,592,396 R316W probably damaging Het
Fat4 T C 3: 39,010,370 L4825P probably damaging Het
Gabbr1 T C 17: 37,070,756 V804A probably damaging Het
Gm1322 G A 2: 67,184,668 noncoding transcript Het
Gm5114 T A 7: 39,408,865 K443N probably benign Het
Gnai2 T C 9: 107,620,187 I3V probably damaging Het
Gp2 G A 7: 119,454,598 P47S possibly damaging Het
I830127L07Rik A T 15: 75,133,719 noncoding transcript Het
Klf15 C A 6: 90,467,360 Q306K possibly damaging Het
Necab2 A T 8: 119,468,293 M295L probably benign Het
Nrg1 A T 8: 31,849,320 Y208N probably damaging Het
Nup88 A T 11: 70,958,430 Y232* probably null Het
Oacyl A G 18: 65,750,182 R611G probably benign Het
Oasl1 T C 5: 114,936,070 probably null Het
Olfr1061 A C 2: 86,413,593 I153R possibly damaging Het
Olfr138 T A 17: 38,275,014 M81K probably damaging Het
Olfr1384 G T 11: 49,514,435 G266C probably damaging Het
Olfr652 T C 7: 104,564,376 Y52H probably benign Het
Pate4 A C 9: 35,607,874 S66A possibly damaging Het
Pigl T A 11: 62,458,483 C8* probably null Het
Plg G A 17: 12,382,183 A51T probably benign Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Ppp1r16a A G 15: 76,694,646 K517E possibly damaging Het
Prr16 A T 18: 51,303,153 S235C probably damaging Het
Psmd1 G A 1: 86,090,183 R572H probably damaging Het
Sbf2 T C 7: 110,377,928 probably benign Het
Scrt2 A T 2: 152,082,123 Y25F probably benign Het
Sema6d A T 2: 124,656,836 H222L probably damaging Het
Sept2 A G 1: 93,497,452 N110S possibly damaging Het
Shpk G A 11: 73,222,781 G340D possibly damaging Het
Smg5 T A 3: 88,354,589 L723H probably damaging Het
Sp110 C T 1: 85,589,120 E219K possibly damaging Het
Spo11 T C 2: 172,989,359 probably benign Het
Srarp T A 4: 141,436,077 probably null Het
Tbc1d5 A G 17: 50,735,967 I831T probably damaging Het
Tm9sf2 A T 14: 122,126,195 Y109F probably damaging Het
Tmem57 A T 4: 134,833,308 C121* probably null Het
Tpcn2 A T 7: 145,255,472 M699K possibly damaging Het
Trim34a T C 7: 104,260,213 F289S possibly damaging Het
Trim39 T C 17: 36,260,753 H371R probably damaging Het
Usp48 T A 4: 137,621,221 I11N possibly damaging Het
Zbtb10 T C 3: 9,280,048 F677L probably benign Het
Zer1 C T 2: 30,110,996 G138S probably damaging Het
Zfp612 A G 8: 110,089,595 K439R possibly damaging Het
Other mutations in Ppig
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00543:Ppig APN 2 69749716 missense unknown
IGL00780:Ppig APN 2 69732924 missense possibly damaging 0.89
IGL02043:Ppig APN 2 69735983 splice site probably null
IGL02420:Ppig APN 2 69732227 missense probably benign 0.03
IGL02736:Ppig APN 2 69736094 missense probably damaging 1.00
R0358:Ppig UTSW 2 69743598 splice site probably benign
R0396:Ppig UTSW 2 69735976 unclassified probably benign
R1035:Ppig UTSW 2 69749459 missense unknown
R1159:Ppig UTSW 2 69750224 missense unknown
R1396:Ppig UTSW 2 69749018 missense unknown
R1593:Ppig UTSW 2 69749081 missense unknown
R1629:Ppig UTSW 2 69735873 missense probably damaging 1.00
R1799:Ppig UTSW 2 69749400 missense unknown
R2001:Ppig UTSW 2 69741644 missense unknown
R2112:Ppig UTSW 2 69750107 missense unknown
R3702:Ppig UTSW 2 69733209 missense probably damaging 1.00
R3855:Ppig UTSW 2 69749375 missense unknown
R4999:Ppig UTSW 2 69741486 missense unknown
R5001:Ppig UTSW 2 69741486 missense unknown
R5153:Ppig UTSW 2 69749650 missense unknown
R5218:Ppig UTSW 2 69732783 intron probably benign
R5336:Ppig UTSW 2 69750224 missense unknown
R5410:Ppig UTSW 2 69735897 missense probably null 1.00
R5513:Ppig UTSW 2 69750359 missense probably benign 0.23
R6179:Ppig UTSW 2 69750127 missense unknown
R6333:Ppig UTSW 2 69749558 missense unknown
R6604:Ppig UTSW 2 69741581 missense unknown
R6932:Ppig UTSW 2 69732411 missense probably benign 0.40
R7206:Ppig UTSW 2 69741566 missense unknown
R7220:Ppig UTSW 2 69749976 missense unknown
R7308:Ppig UTSW 2 69749462 missense unknown
Predicted Primers PCR Primer
(F):5'- GTGTTTGACAGTAAAGAACACATCC -3'
(R):5'- AGCAAGCTCTATCACCTGAGAC -3'

Sequencing Primer
(F):5'- GTTTAAGTGCAAGACCCTGTC -3'
(R):5'- GCAAGCTCTATCACCTGAGACTTTAG -3'
Posted On2017-07-11