Mutagenetix > Incidental Mutations

Incidental Mutation 'R5443:Ddx41'

482214

Institutional Source

Beutler Lab

Gene Symbol

Ddx41

Ensembl Gene

ENSMUSG00000021494

Gene Name

DEAD (Asp-Glu-Ala-Asp) box polypeptide 41

Synonyms

2900024F02Rik

MMRRC Submission

043008-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5443 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

55530410-55536658 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 55535291 bp

Zygosity

Heterozygous

Amino Acid Change

Alanine to Glutamic Acid at position 201 (A201E)

Ref Sequence

ENSEMBL: ENSMUSP00000153348 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021956] [ENSMUST00000021957] [ENSMUST00000224765]

AlphaFold

Q91VN6

Predicted Effect

probably benign
Transcript: ENSMUST00000021956
AA Change: A190E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000021956
Gene: ENSMUSG00000021494
AA Change: A190E

Domain	Start	End	E-Value	Type
low complexity region	24	32	N/A	INTRINSIC
low complexity region	39	56	N/A	INTRINSIC
low complexity region	95	115	N/A	INTRINSIC
DEXDc	200	411	8.56e-53	SMART
HELICc	446	527	5.99e-34	SMART
ZnF_C2HC	581	597	1.98e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000021957

SMART Domains

Protein: ENSMUSP00000021957
Gene: ENSMUSG00000021495

Domain	Start	End	E-Value	Type
low complexity region	55	71	N/A	INTRINSIC
low complexity region	133	144	N/A	INTRINSIC
low complexity region	161	174	N/A	INTRINSIC
low complexity region	198	242	N/A	INTRINSIC
low complexity region	260	286	N/A	INTRINSIC
coiled coil region	371	404	N/A	INTRINSIC
low complexity region	566	573	N/A	INTRINSIC
low complexity region	622	635	N/A	INTRINSIC
low complexity region	641	657	N/A	INTRINSIC
Pfam:FAM193_C	722	776	9.6e-32	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224125

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224486

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224686

Predicted Effect

probably benign
Transcript: ENSMUST00000224765
AA Change: A201E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225184

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225703

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225783

Meta Mutation Damage Score

0.0595

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.9%

Validation Efficiency

99% (68/69)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure, such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of the DEAD box protein family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. The protein encoded by this gene is a member of the DEAD box protein family and interacts with several spliceosomal proteins. In addition, the encoded protein may recognize the bacterial second messengers cyclic di-GMP and cyclic di-AMP, resulting in the induction of genes involved in the innate immune response. [provided by RefSeq, Jan 2017]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110004E09Rik	G	T	16: 90,927,211	Q168K	probably benign	Het
Akap12	A	T	10: 4,355,576	E795D	probably damaging	Het
Aldh6a1	T	C	12: 84,437,971		probably null	Het
Aox4	A	G	1: 58,233,992		probably null	Het
Arhgap39	G	A	15: 76,797,925		probably benign	Het
AW551984	T	C	9: 39,598,029	E272G	possibly damaging	Het
C1qc	G	A	4: 136,892,493		probably benign	Het
Carhsp1	C	A	16: 8,664,339	R26L	probably benign	Het
Cdh12	G	T	15: 21,237,849	V57L	probably benign	Het
Clec3a	A	G	8: 114,418,153	Y23C	probably benign	Het
Crebrf	G	C	17: 26,742,354	V150L	probably damaging	Het
Doc2b	T	C	11: 75,780,095	K237E	probably damaging	Het
Dst	T	C	1: 34,228,539	S5199P	probably damaging	Het
Efnb2	A	G	8: 8,620,862	I129T	probably damaging	Het
Epg5	A	G	18: 78,027,497	E2329G	possibly damaging	Het
Esrrg	A	C	1: 188,043,425	T27P	possibly damaging	Het
Fah	T	A	7: 84,592,396	R316W	probably damaging	Het
Fat4	T	C	3: 39,010,370	L4825P	probably damaging	Het
Gabbr1	T	C	17: 37,070,756	V804A	probably damaging	Het
Gm1322	G	A	2: 67,184,668		noncoding transcript	Het
Gm5114	T	A	7: 39,408,865	K443N	probably benign	Het
Gnai2	T	C	9: 107,620,187	I3V	probably damaging	Het
Gp2	G	A	7: 119,454,598	P47S	possibly damaging	Het
I830127L07Rik	A	T	15: 75,133,719		noncoding transcript	Het
Klf15	C	A	6: 90,467,360	Q306K	possibly damaging	Het
Necab2	A	T	8: 119,468,293	M295L	probably benign	Het
Nrg1	A	T	8: 31,849,320	Y208N	probably damaging	Het
Nup88	A	T	11: 70,958,430	Y232*	probably null	Het
Oacyl	A	G	18: 65,750,182	R611G	probably benign	Het
Oasl1	T	C	5: 114,936,070		probably null	Het
Olfr1061	A	C	2: 86,413,593	I153R	possibly damaging	Het
Olfr138	T	A	17: 38,275,014	M81K	probably damaging	Het
Olfr1384	G	T	11: 49,514,435	G266C	probably damaging	Het
Olfr652	T	C	7: 104,564,376	Y52H	probably benign	Het
Pate4	A	C	9: 35,607,874	S66A	possibly damaging	Het
Pigl	T	A	11: 62,458,483	C8*	probably null	Het
Plg	G	A	17: 12,382,183	A51T	probably benign	Het
Polr3a	T	C	14: 24,454,941	I1084V	possibly damaging	Het
Ppig	A	T	2: 69,734,291	D97V	probably damaging	Het
Ppp1r16a	A	G	15: 76,694,646	K517E	possibly damaging	Het
Prr16	A	T	18: 51,303,153	S235C	probably damaging	Het
Psmd1	G	A	1: 86,090,183	R572H	probably damaging	Het
Sbf2	T	C	7: 110,377,928		probably benign	Het
Scrt2	A	T	2: 152,082,123	Y25F	probably benign	Het
Sema6d	A	T	2: 124,656,836	H222L	probably damaging	Het
Sept2	A	G	1: 93,497,452	N110S	possibly damaging	Het
Shpk	G	A	11: 73,222,781	G340D	possibly damaging	Het
Smg5	T	A	3: 88,354,589	L723H	probably damaging	Het
Sp110	C	T	1: 85,589,120	E219K	possibly damaging	Het
Spo11	T	C	2: 172,989,359		probably benign	Het
Srarp	T	A	4: 141,436,077		probably null	Het
Tbc1d5	A	G	17: 50,735,967	I831T	probably damaging	Het
Tm9sf2	A	T	14: 122,126,195	Y109F	probably damaging	Het
Tmem57	A	T	4: 134,833,308	C121*	probably null	Het
Tpcn2	A	T	7: 145,255,472	M699K	possibly damaging	Het
Trim34a	T	C	7: 104,260,213	F289S	possibly damaging	Het
Trim39	T	C	17: 36,260,753	H371R	probably damaging	Het
Usp48	T	A	4: 137,621,221	I11N	possibly damaging	Het
Zbtb10	T	C	3: 9,280,048	F677L	probably benign	Het
Zer1	C	T	2: 30,110,996	G138S	probably damaging	Het
Zfp612	A	G	8: 110,089,595	K439R	possibly damaging	Het

Other mutations in Ddx41

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00402:Ddx41	APN	13	55531399	missense	probably damaging	1.00
IGL00516:Ddx41	APN	13	55532467	missense	probably damaging	0.96
IGL02383:Ddx41	APN	13	55532357	missense	probably benign	0.04
R0081:Ddx41	UTSW	13	55535380	missense	possibly damaging	0.58
R0097:Ddx41	UTSW	13	55535878	splice site	probably benign
R0412:Ddx41	UTSW	13	55530608	missense	probably damaging	0.99
R0597:Ddx41	UTSW	13	55533006	missense	probably damaging	1.00
R0699:Ddx41	UTSW	13	55531299	splice site	probably benign
R1330:Ddx41	UTSW	13	55534480	missense	possibly damaging	0.87
R1812:Ddx41	UTSW	13	55535954	missense	probably benign	0.03
R2011:Ddx41	UTSW	13	55534093	splice site	probably null
R2224:Ddx41	UTSW	13	55531401	missense	probably damaging	1.00
R2310:Ddx41	UTSW	13	55534480	missense	possibly damaging	0.87
R2311:Ddx41	UTSW	13	55534480	missense	possibly damaging	0.87
R2355:Ddx41	UTSW	13	55534300	missense	probably benign	0.03
R2983:Ddx41	UTSW	13	55534480	missense	possibly damaging	0.87
R3032:Ddx41	UTSW	13	55534480	missense	possibly damaging	0.87
R3764:Ddx41	UTSW	13	55534480	missense	possibly damaging	0.87
R3773:Ddx41	UTSW	13	55534480	missense	possibly damaging	0.87
R3916:Ddx41	UTSW	13	55534480	missense	possibly damaging	0.87
R3926:Ddx41	UTSW	13	55531270	missense	probably damaging	1.00
R4153:Ddx41	UTSW	13	55534480	missense	possibly damaging	0.87
R4154:Ddx41	UTSW	13	55534480	missense	possibly damaging	0.87
R4372:Ddx41	UTSW	13	55534480	missense	possibly damaging	0.87
R4470:Ddx41	UTSW	13	55534480	missense	possibly damaging	0.87
R4519:Ddx41	UTSW	13	55533144	missense	probably damaging	1.00
R4569:Ddx41	UTSW	13	55536021	missense	possibly damaging	0.88
R4823:Ddx41	UTSW	13	55532055	missense	probably benign	0.02
R4837:Ddx41	UTSW	13	55531648	missense	possibly damaging	0.95
R5642:Ddx41	UTSW	13	55535895	missense	possibly damaging	0.86
R5926:Ddx41	UTSW	13	55534299	missense	probably damaging	0.99
R5949:Ddx41	UTSW	13	55532061	missense	probably damaging	1.00
R6035:Ddx41	UTSW	13	55533968	missense	probably benign	0.00
R6035:Ddx41	UTSW	13	55533968	missense	probably benign	0.00
R7254:Ddx41	UTSW	13	55533956	nonsense	probably null
R7640:Ddx41	UTSW	13	55534239	missense	possibly damaging	0.81
R7803:Ddx41	UTSW	13	55531921	missense	probably damaging	1.00
R8690:Ddx41	UTSW	13	55533126	missense	probably damaging	1.00
R8714:Ddx41	UTSW	13	55534437	missense	probably damaging	1.00
R9071:Ddx41	UTSW	13	55532406	missense	probably damaging	0.96
R9089:Ddx41	UTSW	13	55535611	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- ATAAGTCCAAAGAAACCCTTCCT -3'
(R):5'- ATACTCTACCGTGTTGCCCT -3'

Sequencing Primer
(F):5'- GACACGTGGTTTCACAACTG -3'
(R):5'- ACCGTGTTGCCCTCTCCTG -3'

Posted On

2017-07-11