Incidental Mutation 'R5524:Agbl5'
ID482216
Institutional Source Beutler Lab
Gene Symbol Agbl5
Ensembl Gene ENSMUSG00000029165
Gene NameATP/GTP binding protein-like 5
Synonyms
MMRRC Submission 043082-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5524 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location30888694-30906965 bp(+) (GRCm38)
Type of Mutationunclassified (2034 bp from exon)
DNA Base Change (assembly) G to A at 30893903 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000144274 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069705] [ENSMUST00000114700] [ENSMUST00000200695] [ENSMUST00000200850] [ENSMUST00000201168] [ENSMUST00000201225] [ENSMUST00000201817] [ENSMUST00000201917] [ENSMUST00000202060] [ENSMUST00000202109]
Predicted Effect silent
Transcript: ENSMUST00000069705
SMART Domains Protein: ENSMUSP00000063228
Gene: ENSMUSG00000029165

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
Pfam:Peptidase_M14 191 361 8.4e-19 PFAM
low complexity region 384 399 N/A INTRINSIC
Blast:Zn_pept 424 489 4e-14 BLAST
low complexity region 538 548 N/A INTRINSIC
low complexity region 643 654 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000114700
SMART Domains Protein: ENSMUSP00000110348
Gene: ENSMUSG00000029165

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
Pfam:Peptidase_M14 220 390 1.1e-18 PFAM
low complexity region 413 428 N/A INTRINSIC
Blast:Zn_pept 453 518 5e-14 BLAST
low complexity region 567 577 N/A INTRINSIC
low complexity region 672 683 N/A INTRINSIC
low complexity region 743 762 N/A INTRINSIC
low complexity region 766 787 N/A INTRINSIC
low complexity region 824 835 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000134956
AA Change: W481*
Predicted Effect probably null
Transcript: ENSMUST00000200695
SMART Domains Protein: ENSMUSP00000144109
Gene: ENSMUSG00000029165

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
SCOP:d2ctc__ 148 177 5e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000200850
SMART Domains Protein: ENSMUSP00000144274
Gene: ENSMUSG00000029165

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
SCOP:d1jqga1 178 229 1e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200990
Predicted Effect probably benign
Transcript: ENSMUST00000201014
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201167
Predicted Effect silent
Transcript: ENSMUST00000201168
SMART Domains Protein: ENSMUSP00000143808
Gene: ENSMUSG00000029165

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
Pfam:Peptidase_M14 196 370 7.3e-13 PFAM
low complexity region 384 399 N/A INTRINSIC
Blast:Zn_pept 424 489 5e-14 BLAST
low complexity region 538 548 N/A INTRINSIC
low complexity region 643 654 N/A INTRINSIC
low complexity region 714 733 N/A INTRINSIC
low complexity region 737 758 N/A INTRINSIC
low complexity region 836 847 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000201225
SMART Domains Protein: ENSMUSP00000143934
Gene: ENSMUSG00000029165

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
Pfam:Peptidase_M14 196 373 5.9e-13 PFAM
low complexity region 384 399 N/A INTRINSIC
Blast:Zn_pept 424 489 5e-14 BLAST
low complexity region 538 548 N/A INTRINSIC
low complexity region 643 654 N/A INTRINSIC
low complexity region 714 733 N/A INTRINSIC
low complexity region 752 768 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201523
Predicted Effect silent
Transcript: ENSMUST00000201817
SMART Domains Protein: ENSMUSP00000144304
Gene: ENSMUSG00000029165

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
Pfam:Peptidase_M14 196 372 6.4e-13 PFAM
low complexity region 384 399 N/A INTRINSIC
Blast:Zn_pept 424 489 5e-14 BLAST
low complexity region 538 548 N/A INTRINSIC
low complexity region 643 654 N/A INTRINSIC
low complexity region 714 733 N/A INTRINSIC
low complexity region 737 758 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201901
Predicted Effect silent
Transcript: ENSMUST00000201917
SMART Domains Protein: ENSMUSP00000144188
Gene: ENSMUSG00000029165

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
Pfam:Peptidase_M14 196 372 6.5e-13 PFAM
low complexity region 384 399 N/A INTRINSIC
Blast:Zn_pept 424 489 5e-14 BLAST
low complexity region 538 548 N/A INTRINSIC
low complexity region 643 654 N/A INTRINSIC
low complexity region 714 733 N/A INTRINSIC
low complexity region 737 758 N/A INTRINSIC
low complexity region 795 806 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201918
Predicted Effect silent
Transcript: ENSMUST00000202060
SMART Domains Protein: ENSMUSP00000144018
Gene: ENSMUSG00000029165

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
Pfam:Peptidase_M14 196 373 5.9e-13 PFAM
low complexity region 384 399 N/A INTRINSIC
Blast:Zn_pept 424 489 5e-14 BLAST
low complexity region 538 548 N/A INTRINSIC
low complexity region 643 654 N/A INTRINSIC
low complexity region 714 733 N/A INTRINSIC
low complexity region 752 768 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202109
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202565
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202757
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202893
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.4%
  • 20x: 91.4%
Validation Efficiency 100% (76/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a metallocarboxypeptidase involved in protein deglutamylation and a member of the peptidase M14 family of proteins. The encoded protein has been described as a "dual-functional" deglutamylase that can remove glutamate residues from both carboxyl termini and side chains of protein substrates. This deglutamylase activity may be important in antiviral immunity. Mutations in this gene are associated with retinitis pigmentosa. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to HSV or VACV infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010L04Rik T A 7: 82,853,942 noncoding transcript Het
6030469F06Rik A G 12: 31,184,863 noncoding transcript Het
A830031A19Rik T A 11: 24,058,776 I13F unknown Het
Acsbg2 A C 17: 56,850,197 L309R probably damaging Het
Adam32 A T 8: 24,922,312 M76K probably damaging Het
Adamts14 C A 10: 61,230,443 R297L probably damaging Het
Asb14 A G 14: 26,900,451 K80E possibly damaging Het
Baiap2l1 T C 5: 144,280,949 T276A probably benign Het
Cacna1d G A 14: 30,042,129 P2127S probably benign Het
Ces2g A G 8: 104,966,895 T403A probably benign Het
Cgn A C 3: 94,779,989 M1R probably null Het
Chd5 T G 4: 152,376,630 S1226A probably benign Het
Col18a1 A G 10: 77,058,724 V1497A probably damaging Het
Cpd A T 11: 76,797,901 Y848* probably null Het
Cyp2a12 T C 7: 27,031,231 V207A probably benign Het
Cyth1 G A 11: 118,182,767 R247W probably benign Het
Derl3 T C 10: 75,894,490 V129A possibly damaging Het
Ehmt2 C T 17: 34,899,091 R40* probably null Het
Eml1 A T 12: 108,521,376 I518L probably damaging Het
Eri1 A G 8: 35,478,609 V174A probably benign Het
Fgd3 T A 13: 49,277,577 I435F probably damaging Het
Foxd1 T G 13: 98,355,904 S429A unknown Het
Ftcd T A 10: 76,589,331 probably benign Het
Gm5478 G T 15: 101,644,667 N323K probably benign Het
Gnpda1 G T 18: 38,335,108 P45Q probably damaging Het
Kif20a G T 18: 34,630,625 probably null Het
Klrb1 T C 6: 128,712,333 probably null Het
Lcorl C A 5: 45,775,522 probably null Het
Lcorl T A 5: 45,775,523 probably null Het
Lrp1b T A 2: 41,110,888 K2108M probably damaging Het
Lyst C T 13: 13,746,779 P3437S probably benign Het
Macrod2 A T 2: 142,317,943 M349L possibly damaging Het
March7 T C 2: 60,245,303 probably benign Het
Mcm9 A T 10: 53,548,690 C601* probably null Het
Muc19 G T 15: 91,894,393 noncoding transcript Het
Mycbp2 T C 14: 103,295,237 D427G probably damaging Het
Nap1l5 C A 6: 58,906,778 V64L possibly damaging Het
Ncam2 C T 16: 81,434,878 R77* probably null Het
Npas3 T C 12: 54,068,938 V863A possibly damaging Het
Nr2c2 T A 6: 92,139,765 probably null Het
Olfr181 C T 16: 58,925,809 C254Y probably benign Het
Olfr43 A T 11: 74,206,583 L211Q probably damaging Het
Olfr44 C T 9: 39,484,987 V89M probably damaging Het
Oosp3 T C 19: 11,705,430 F56S possibly damaging Het
Plgrkt G A 19: 29,350,450 P78S probably damaging Het
Prss36 G A 7: 127,934,465 Q56* probably null Het
Ptprz1 A G 6: 22,986,318 probably null Het
Qsox2 A T 2: 26,217,687 F265I probably damaging Het
R3hcc1l G T 19: 42,563,868 E435* probably null Het
Shbg T C 11: 69,616,762 D163G probably benign Het
Skint7 T A 4: 111,980,349 L108H probably damaging Het
Smtnl1 T A 2: 84,818,894 E5D probably benign Het
Spock1 C T 13: 57,556,795 G120D probably damaging Het
Stk11ip G T 1: 75,532,327 C700F probably damaging Het
Sult4a1 C T 15: 84,089,958 probably null Het
Syngap1 A G 17: 26,957,152 H138R probably damaging Het
Tdrd7 A G 4: 46,034,301 K1016E probably benign Het
Tmem167b T C 3: 108,560,253 K26E possibly damaging Het
Tnfaip3 A G 10: 19,008,195 S146P probably damaging Het
Ttn C T 2: 76,776,716 V16242I possibly damaging Het
Vmn2r-ps3 T A 3: 64,053,449 noncoding transcript Het
Vps13c T C 9: 67,957,556 F3049S probably damaging Het
Vstm2l T C 2: 157,935,435 W78R probably damaging Het
Wbp1l C A 19: 46,654,256 A216D possibly damaging Het
Zer1 C G 2: 30,104,854 V510L probably damaging Het
Zfp28 A T 7: 6,394,851 probably null Het
Zfp352 C A 4: 90,225,104 P494T possibly damaging Het
Zfp353-ps A G 8: 42,082,563 noncoding transcript Het
Zfp563 A T 17: 33,102,541 probably null Het
Zim1 T C 7: 6,677,321 N448D probably benign Het
Other mutations in Agbl5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01315:Agbl5 APN 5 30893234 missense probably benign 0.00
sausage UTSW 5 30894358 nonsense probably null
R0355:Agbl5 UTSW 5 30891991 critical splice donor site probably null
R0575:Agbl5 UTSW 5 30894454 missense probably damaging 1.00
R1694:Agbl5 UTSW 5 30893382 missense probably damaging 1.00
R1709:Agbl5 UTSW 5 30906241 missense probably damaging 1.00
R1829:Agbl5 UTSW 5 30903064 missense possibly damaging 0.66
R2434:Agbl5 UTSW 5 30894013 missense probably damaging 0.97
R3418:Agbl5 UTSW 5 30904723 missense probably damaging 1.00
R4827:Agbl5 UTSW 5 30895814 missense probably damaging 1.00
R4828:Agbl5 UTSW 5 30890715 missense probably damaging 1.00
R4830:Agbl5 UTSW 5 30890715 missense probably damaging 1.00
R5017:Agbl5 UTSW 5 30903059 missense probably damaging 1.00
R5018:Agbl5 UTSW 5 30903059 missense probably damaging 1.00
R5036:Agbl5 UTSW 5 30903059 missense probably damaging 1.00
R5038:Agbl5 UTSW 5 30903059 missense probably damaging 1.00
R5052:Agbl5 UTSW 5 30891214 missense possibly damaging 0.76
R5071:Agbl5 UTSW 5 30903059 missense probably damaging 1.00
R5073:Agbl5 UTSW 5 30903059 missense probably damaging 1.00
R5074:Agbl5 UTSW 5 30903059 missense probably damaging 1.00
R5081:Agbl5 UTSW 5 30903059 missense probably damaging 1.00
R5083:Agbl5 UTSW 5 30903059 missense probably damaging 1.00
R5103:Agbl5 UTSW 5 30894001 missense probably damaging 1.00
R5107:Agbl5 UTSW 5 30892478 missense probably damaging 1.00
R5130:Agbl5 UTSW 5 30903059 missense probably damaging 1.00
R5395:Agbl5 UTSW 5 30890338 missense probably damaging 1.00
R5522:Agbl5 UTSW 5 30893903 unclassified probably null
R5526:Agbl5 UTSW 5 30893903 unclassified probably null
R5657:Agbl5 UTSW 5 30894046 missense probably damaging 1.00
R5790:Agbl5 UTSW 5 30894358 nonsense probably null
R6301:Agbl5 UTSW 5 30891833 missense probably damaging 1.00
R6891:Agbl5 UTSW 5 30895178 missense probably damaging 1.00
R6919:Agbl5 UTSW 5 30904717 missense probably benign 0.13
R7388:Agbl5 UTSW 5 30903239 nonsense probably null
R7392:Agbl5 UTSW 5 30890771 critical splice donor site probably null
R7410:Agbl5 UTSW 5 30890688 missense possibly damaging 0.94
R7452:Agbl5 UTSW 5 30893391 missense probably damaging 1.00
RF007:Agbl5 UTSW 5 30903245 missense unknown
Predicted Primers PCR Primer
(F):5'- CGTCTTCCATAGAGCTGAGAACC -3'
(R):5'- ACCTGTGGATTATCCCTGAGG -3'

Sequencing Primer
(F):5'- TCTGAGCTTAAAAGAAACAGTGC -3'
(R):5'- AGGCTTTGTAGATTGCGACAC -3'
Posted On2017-07-11