Incidental Mutation 'R0517:Dpysl5'
ID 48222
Institutional Source Beutler Lab
Gene Symbol Dpysl5
Ensembl Gene ENSMUSG00000029168
Gene Name dihydropyrimidinase-like 5
Synonyms CRMP-5, Crmp5, CRAM
MMRRC Submission 038710-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.234) question?
Stock # R0517 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 30868908-30956713 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 30935410 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 171 (D171G)
Ref Sequence ENSEMBL: ENSMUSP00000110377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088081] [ENSMUST00000114729]
AlphaFold Q9EQF6
Predicted Effect probably damaging
Transcript: ENSMUST00000088081
AA Change: D171G

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000085400
Gene: ENSMUSG00000029168
AA Change: D171G

DomainStartEndE-ValueType
Pfam:Amidohydro_5 28 97 3.4e-11 PFAM
Pfam:Amidohydro_4 52 403 4.3e-17 PFAM
Pfam:Amidohydro_1 57 406 2.3e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114729
AA Change: D171G

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110377
Gene: ENSMUSG00000029168
AA Change: D171G

DomainStartEndE-ValueType
Pfam:Amidohydro_1 57 446 1.1e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127365
Meta Mutation Damage Score 0.9149 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 92.1%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the CRMP (collapsing response mediator protein) family thought to be involved in neural development. Antibodies to the encoded protein were found in some patients with neurologic symptoms who had paraneoplastic syndrome. A pseudogene of this gene is found on chromosome 11. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit limb grasping, abnormal Purkinje morphology, absent long term depression, and no response to BDNF. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410137M14Rik T A 17: 37,292,024 (GRCm39) probably benign Het
Acer1 T C 17: 57,262,569 (GRCm39) T194A probably benign Het
Adamts1 C A 16: 85,597,241 (GRCm39) D10Y possibly damaging Het
Adamts7 T C 9: 90,081,911 (GRCm39) V1612A probably benign Het
Adcyap1r1 T A 6: 55,468,282 (GRCm39) S373T probably damaging Het
Asic5 A T 3: 81,916,833 (GRCm39) I266F probably benign Het
Cacna1d A T 14: 29,901,232 (GRCm39) I274K probably damaging Het
Camsap2 G T 1: 136,221,126 (GRCm39) Q238K possibly damaging Het
Ceacam15 A C 7: 16,407,445 (GRCm39) L24* probably null Het
Cerk G A 15: 86,040,849 (GRCm39) T170I probably damaging Het
Cyp27b1 T C 10: 126,885,985 (GRCm39) probably null Het
Cyp2c65 T C 19: 39,070,792 (GRCm39) probably benign Het
Dennd5a A G 7: 109,533,968 (GRCm39) S75P probably damaging Het
Dhx9 C T 1: 153,354,662 (GRCm39) A146T possibly damaging Het
Dsg3 A G 18: 20,662,082 (GRCm39) N449S probably benign Het
Eps8l3 T C 3: 107,790,776 (GRCm39) S189P probably benign Het
Exph5 A G 9: 53,284,062 (GRCm39) E381G probably benign Het
Fbxo46 A G 7: 18,870,799 (GRCm39) M473V possibly damaging Het
Fgf14 G A 14: 124,221,196 (GRCm39) P203S probably damaging Het
Foxf2 C T 13: 31,810,226 (GRCm39) A55V unknown Het
Galnt5 T G 2: 57,925,385 (GRCm39) probably benign Het
Glis2 T C 16: 4,429,416 (GRCm39) L181P probably damaging Het
Gm10000 T G 12: 104,442,667 (GRCm39) probably benign Het
Helz2 A G 2: 180,869,563 (GRCm39) S2959P probably benign Het
Hyal6 A G 6: 24,734,852 (GRCm39) N262D probably benign Het
Lgr4 T C 2: 109,841,665 (GRCm39) L526P probably damaging Het
Mapk1 A T 16: 16,833,910 (GRCm39) I88F probably benign Het
Mpg A T 11: 32,181,853 (GRCm39) H287L probably benign Het
Mpp4 A T 1: 59,163,886 (GRCm39) Y489* probably null Het
Mpzl1 T C 1: 165,429,359 (GRCm39) E224G probably damaging Het
Myh10 A G 11: 68,702,425 (GRCm39) probably null Het
Odad2 A C 18: 7,223,621 (GRCm39) L474R probably damaging Het
Or13p8 T A 4: 118,583,831 (GRCm39) I129K probably damaging Het
Or5m9 T C 2: 85,877,548 (GRCm39) S241P probably damaging Het
Paip1 T A 13: 119,584,326 (GRCm39) F196I probably damaging Het
Pde3a A T 6: 141,444,383 (GRCm39) K1064* probably null Het
Pira2 A T 7: 3,847,196 (GRCm39) probably benign Het
Pros1 A G 16: 62,723,881 (GRCm39) S210G probably benign Het
Rbm15 A T 3: 107,238,685 (GRCm39) L571Q probably damaging Het
Scn1a T A 2: 66,132,751 (GRCm39) T1194S possibly damaging Het
Sema6a G A 18: 47,423,112 (GRCm39) probably null Het
Serpina1e G A 12: 103,915,486 (GRCm39) T240I probably benign Het
Setx T G 2: 29,047,145 (GRCm39) S1874R probably benign Het
Sgsm2 G T 11: 74,758,477 (GRCm39) T256K possibly damaging Het
Slc44a1 T C 4: 53,542,366 (GRCm39) V300A probably damaging Het
Spata46 A G 1: 170,139,178 (GRCm39) Y59C probably damaging Het
Supt3 T C 17: 45,430,158 (GRCm39) F404L probably benign Het
Tars1 T A 15: 11,394,452 (GRCm39) K62* probably null Het
Tas2r139 A C 6: 42,118,425 (GRCm39) T186P probably damaging Het
Tasor2 T A 13: 3,616,964 (GRCm39) T2367S possibly damaging Het
Tc2n C T 12: 101,615,454 (GRCm39) S457N probably damaging Het
Tox4 A T 14: 52,530,085 (GRCm39) S582C probably benign Het
Trappc12 T C 12: 28,747,133 (GRCm39) probably benign Het
Ubqlnl G T 7: 103,797,845 (GRCm39) Q551K probably damaging Het
Ubr4 A G 4: 139,119,435 (GRCm39) T205A probably benign Het
Urb1 G A 16: 90,574,310 (GRCm39) Q924* probably null Het
Vmn1r49 A G 6: 90,049,720 (GRCm39) L94P probably damaging Het
Vmn2r120 T C 17: 57,815,949 (GRCm39) Y802C probably damaging Het
Xrcc1 C T 7: 24,269,744 (GRCm39) probably benign Het
Other mutations in Dpysl5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02177:Dpysl5 APN 5 30,902,622 (GRCm39) missense probably damaging 1.00
IGL02277:Dpysl5 APN 5 30,946,125 (GRCm39) missense probably damaging 1.00
R0788:Dpysl5 UTSW 5 30,946,185 (GRCm39) critical splice donor site probably null
R1716:Dpysl5 UTSW 5 30,935,338 (GRCm39) missense probably benign 0.00
R2016:Dpysl5 UTSW 5 30,948,941 (GRCm39) missense probably damaging 1.00
R2208:Dpysl5 UTSW 5 30,948,941 (GRCm39) missense probably damaging 1.00
R2211:Dpysl5 UTSW 5 30,948,941 (GRCm39) missense probably damaging 1.00
R2965:Dpysl5 UTSW 5 30,948,941 (GRCm39) missense probably damaging 1.00
R4440:Dpysl5 UTSW 5 30,949,612 (GRCm39) missense probably damaging 0.99
R4863:Dpysl5 UTSW 5 30,941,687 (GRCm39) missense probably benign 0.08
R4918:Dpysl5 UTSW 5 30,949,612 (GRCm39) missense probably damaging 1.00
R5377:Dpysl5 UTSW 5 30,948,857 (GRCm39) missense probably damaging 1.00
R6379:Dpysl5 UTSW 5 30,935,317 (GRCm39) critical splice acceptor site probably null
R6621:Dpysl5 UTSW 5 30,941,813 (GRCm39) critical splice donor site probably null
R7199:Dpysl5 UTSW 5 30,940,539 (GRCm39) missense probably benign 0.21
R7232:Dpysl5 UTSW 5 30,949,642 (GRCm39) missense probably benign 0.03
R7388:Dpysl5 UTSW 5 30,902,805 (GRCm39) missense probably benign
R7446:Dpysl5 UTSW 5 30,936,231 (GRCm39) missense probably benign 0.00
R7868:Dpysl5 UTSW 5 30,902,760 (GRCm39) missense probably damaging 1.00
R8041:Dpysl5 UTSW 5 30,953,658 (GRCm39) missense probably benign 0.28
R8428:Dpysl5 UTSW 5 30,902,811 (GRCm39) missense probably damaging 0.99
R8835:Dpysl5 UTSW 5 30,936,282 (GRCm39) critical splice donor site probably null
R8888:Dpysl5 UTSW 5 30,902,687 (GRCm39) missense probably benign 0.01
R8943:Dpysl5 UTSW 5 30,935,375 (GRCm39) missense probably benign 0.33
R9033:Dpysl5 UTSW 5 30,948,941 (GRCm39) missense probably damaging 1.00
R9139:Dpysl5 UTSW 5 30,935,397 (GRCm39) missense probably benign 0.45
R9305:Dpysl5 UTSW 5 30,948,959 (GRCm39) missense probably damaging 1.00
R9522:Dpysl5 UTSW 5 30,935,399 (GRCm39) nonsense probably null
R9700:Dpysl5 UTSW 5 30,904,417 (GRCm39) nonsense probably null
Z1176:Dpysl5 UTSW 5 30,935,464 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GACCCGAGAAACAGTTGGTCACAG -3'
(R):5'- TTGGCACCCCAGATGTTCACAC -3'

Sequencing Primer
(F):5'- ACAGTTGGTCACAGCCTGC -3'
(R):5'- GATGTTCACACCTCACAGCG -3'
Posted On 2013-06-12