Incidental Mutation 'R6082:Scnm1'
ID 482226
Institutional Source Beutler Lab
Gene Symbol Scnm1
Ensembl Gene ENSMUSG00000092607
Gene Name sodium channel modifier 1
Synonyms 3110001I17Rik, Scnm1-ps
MMRRC Submission 044241-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.152) question?
Stock # R6082 (G1)
Quality Score 212.009
Status Not validated
Chromosome 3
Chromosomal Location 95037030-95041285 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 95037596 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 157 (I157V)
Ref Sequence ENSEMBL: ENSMUSP00000134337 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005769] [ENSMUST00000066386] [ENSMUST00000107227] [ENSMUST00000131597] [ENSMUST00000172572] [ENSMUST00000173462]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000005769
SMART Domains Protein: ENSMUSP00000005769
Gene: ENSMUSG00000005628

DomainStartEndE-ValueType
Pfam:Tropomodulin 4 143 2.7e-62 PFAM
PDB:1IO0|A 160 343 6e-77 PDB
SCOP:d1a4ya_ 184 289 4e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000066386
SMART Domains Protein: ENSMUSP00000067811
Gene: ENSMUSG00000053769

DomainStartEndE-ValueType
low complexity region 10 19 N/A INTRINSIC
LysM 41 85 2.58e-7 SMART
low complexity region 100 108 N/A INTRINSIC
low complexity region 117 132 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107227
SMART Domains Protein: ENSMUSP00000102846
Gene: ENSMUSG00000005628

DomainStartEndE-ValueType
Pfam:Tropomodulin 1 144 4.4e-72 PFAM
PDB:1IO0|A 160 343 6e-77 PDB
SCOP:d1a4ya_ 184 289 4e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130545
Predicted Effect probably benign
Transcript: ENSMUST00000131597
SMART Domains Protein: ENSMUSP00000116341
Gene: ENSMUSG00000005628

DomainStartEndE-ValueType
Pfam:Tropomodulin 1 144 1.5e-72 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135867
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199730
Predicted Effect probably benign
Transcript: ENSMUST00000172572
AA Change: I157V

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000134337
Gene: ENSMUSG00000092607
AA Change: I157V

DomainStartEndE-ValueType
Pfam:zf-SCNM1 44 70 7.6e-19 PFAM
low complexity region 133 148 N/A INTRINSIC
low complexity region 172 179 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174508
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174835
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174859
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149898
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196728
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173527
Predicted Effect probably benign
Transcript: ENSMUST00000173462
SMART Domains Protein: ENSMUSP00000133769
Gene: ENSMUSG00000092607

DomainStartEndE-ValueType
Blast:ZnF_C2H2 42 68 2e-7 BLAST
Meta Mutation Damage Score 0.0663 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: Mutations in the voltage-gated sodium channel gene Scn8a lead to neurological problems in mice. For one particular mutation, Scn8amedJ, mice live to adulthood but have tremors and muscle weakness, among other problems, in all strains except those derived from C57BL6 mice. In these strains, the product of the Scnm1 gene (229 aa) partially overcomes the effects of the Scn8amedJ mutation. However, in C57BL6-derived mice, a one nt change in the penultimate exon creates a premature stop codon, truncating the Scnm1 protein at 186 aa. This truncated protein lacks the ability to overcome the effects of the Scn8amedJ mutation, and these mice suffer paralysis and juvenile death. [provided by RefSeq, Jul 2009]
PHENOTYPE: The Scnm1 locus influences the severity of the Scn8amed-J phenotype. Mice carrying the recesive susceptibility allele of the modifier are paralyzed and do not survive beyond 1 month. Mice carryimg the resistant allele display progressive dystonia with ataxia and live more than 1.5 years. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(6) Spontaneous(1) Chemically induced(1)

Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik T C 1: 11,868,752 (GRCm39) I344T probably benign Het
Adamts19 G A 18: 59,101,846 (GRCm39) A639T probably benign Het
Adamts9 T C 6: 92,866,930 (GRCm39) D122G probably damaging Het
Bin2 A G 15: 100,543,029 (GRCm39) S358P possibly damaging Het
Bora A T 14: 99,299,730 (GRCm39) Q234L possibly damaging Het
Btaf1 C T 19: 36,960,942 (GRCm39) R772C probably damaging Het
Cenpf T C 1: 189,390,301 (GRCm39) E1177G probably benign Het
Clec4b2 A T 6: 123,181,100 (GRCm39) probably null Het
Dedd2 G A 7: 24,910,715 (GRCm39) P154S probably benign Het
Dennd5b A G 6: 148,970,193 (GRCm39) S87P probably damaging Het
Dhx8 C T 11: 101,655,139 (GRCm39) R1050W probably damaging Het
Eif3a T C 19: 60,760,568 (GRCm39) K682R possibly damaging Het
Eif4e2 G T 1: 87,153,956 (GRCm39) probably null Het
Ephb1 T C 9: 101,848,303 (GRCm39) D665G probably damaging Het
Gbp7 G A 3: 142,251,697 (GRCm39) V515M probably benign Het
Hnrnpdl C T 5: 100,184,340 (GRCm39) G398S probably null Het
Hook3 C A 8: 26,600,813 (GRCm39) A32S probably benign Het
Hoxb4 T C 11: 96,209,359 (GRCm39) probably benign Het
Idi1 T A 13: 8,940,506 (GRCm39) Y229* probably null Het
Lpl A T 8: 69,349,301 (GRCm39) I276F probably damaging Het
Ltbp4 T C 7: 27,035,105 (GRCm39) probably benign Het
Mphosph8 A G 14: 56,905,998 (GRCm39) I64V probably damaging Het
Mroh1 A G 15: 76,314,423 (GRCm39) D700G probably benign Het
Myt1l G A 12: 29,882,331 (GRCm39) G509R unknown Het
Myt1l T C 12: 29,892,518 (GRCm39) Y52H probably damaging Het
Nlrp9a T A 7: 26,267,402 (GRCm39) D777E probably benign Het
Nudt4 A G 10: 95,387,318 (GRCm39) I82T probably benign Het
Nwd2 T C 5: 63,962,374 (GRCm39) C653R possibly damaging Het
Obscn A G 11: 58,890,393 (GRCm39) Y7380H unknown Het
Or13a18 A G 7: 140,190,594 (GRCm39) T172A probably benign Het
Or8b3b C A 9: 38,583,866 (GRCm39) R291S probably damaging Het
Or8j3 A C 2: 86,028,661 (GRCm39) V145G probably damaging Het
Or8s8 C T 15: 98,354,647 (GRCm39) A152V probably damaging Het
Ptk2 A T 15: 73,148,714 (GRCm39) M409K probably damaging Het
Ptpn11 T C 5: 121,292,589 (GRCm39) T253A probably benign Het
Rabl6 C T 2: 25,473,837 (GRCm39) probably benign Het
Rnf14 T C 18: 38,434,723 (GRCm39) S57P possibly damaging Het
Slco1b2 A C 6: 141,609,396 (GRCm39) I269L probably benign Het
Smchd1 A G 17: 71,656,714 (GRCm39) Y1918H probably benign Het
Spag17 A T 3: 100,031,501 (GRCm39) I2255F possibly damaging Het
Spata31g1 A G 4: 42,972,511 (GRCm39) M615V probably benign Het
Tnnt2 A G 1: 135,777,172 (GRCm39) M199V probably benign Het
Tymp GC GCC 15: 89,258,567 (GRCm39) probably null Het
Vmn2r73 T A 7: 85,507,429 (GRCm39) I628L probably benign Het
Zc2hc1b C A 10: 13,047,055 (GRCm39) E19* probably null Het
Other mutations in Scnm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02964:Scnm1 APN 3 95,040,348 (GRCm39) missense probably benign 0.07
R1917:Scnm1 UTSW 3 95,037,584 (GRCm39) missense possibly damaging 0.59
R5538:Scnm1 UTSW 3 95,037,066 (GRCm39) utr 3 prime probably benign
R5888:Scnm1 UTSW 3 95,037,596 (GRCm39) missense probably benign 0.06
R5955:Scnm1 UTSW 3 95,037,596 (GRCm39) missense probably benign 0.06
R5956:Scnm1 UTSW 3 95,037,596 (GRCm39) missense probably benign 0.06
R6086:Scnm1 UTSW 3 95,037,596 (GRCm39) missense probably benign 0.06
R7182:Scnm1 UTSW 3 95,041,165 (GRCm39) missense possibly damaging 0.60
R7206:Scnm1 UTSW 3 95,041,205 (GRCm39) start codon destroyed probably null 1.00
R7605:Scnm1 UTSW 3 95,040,186 (GRCm39) missense probably benign 0.03
R8517:Scnm1 UTSW 3 95,040,134 (GRCm39) critical splice donor site probably null
Z1176:Scnm1 UTSW 3 95,037,652 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACTTACAGAAGTGTGCCCC -3'
(R):5'- AATCAGTTTCAAGCGCTGCTC -3'

Sequencing Primer
(F):5'- CTTACAGAAGTGTGCCCCTATAAAG -3'
(R):5'- AAGCGCTGCTCTTCTGG -3'
Posted On 2017-07-14