Incidental Mutation 'R6082:Hnrnpdl'
ID 482231
Institutional Source Beutler Lab
Gene Symbol Hnrnpdl
Ensembl Gene ENSMUSG00000029328
Gene Name heterogeneous nuclear ribonucleoprotein D-like
Synonyms D5Wsu145e, hnRNP-DL, D5Ertd650e, Hnrpdl, JKTBP
MMRRC Submission 044241-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.243) question?
Stock # R6082 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 100181436-100187523 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 100184340 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Serine at position 398 (G398S)
Ref Sequence ENSEMBL: ENSMUSP00000121005 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031268] [ENSMUST00000086900] [ENSMUST00000128187] [ENSMUST00000149384] [ENSMUST00000169390]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000031268
SMART Domains Protein: ENSMUSP00000031268
Gene: ENSMUSG00000029326

DomainStartEndE-ValueType
Pfam:HAD_2 13 227 2.6e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000086900
AA Change: G398S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000084114
Gene: ENSMUSG00000029328
AA Change: G398S

DomainStartEndE-ValueType
low complexity region 31 57 N/A INTRINSIC
low complexity region 70 88 N/A INTRINSIC
low complexity region 99 109 N/A INTRINSIC
RRM 149 221 1.74e-23 SMART
RRM 234 306 3.56e-20 SMART
low complexity region 315 344 N/A INTRINSIC
low complexity region 347 362 N/A INTRINSIC
low complexity region 370 393 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000128187
AA Change: G398S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000121005
Gene: ENSMUSG00000029328
AA Change: G398S

DomainStartEndE-ValueType
low complexity region 31 57 N/A INTRINSIC
low complexity region 70 88 N/A INTRINSIC
low complexity region 99 109 N/A INTRINSIC
RRM 149 221 1.74e-23 SMART
RRM 234 306 3.56e-20 SMART
low complexity region 315 344 N/A INTRINSIC
low complexity region 347 362 N/A INTRINSIC
low complexity region 370 393 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135424
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141337
Predicted Effect probably benign
Transcript: ENSMUST00000149384
SMART Domains Protein: ENSMUSP00000117589
Gene: ENSMUSG00000029328

DomainStartEndE-ValueType
low complexity region 10 20 N/A INTRINSIC
Blast:RRM 28 59 1e-13 BLAST
low complexity region 63 83 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000153442
AA Change: G300S

PolyPhen 2 Score 0.369 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000118555
Gene: ENSMUSG00000029328
AA Change: G300S

DomainStartEndE-ValueType
RRM 52 124 1.74e-23 SMART
RRM 137 209 3.56e-20 SMART
low complexity region 218 247 N/A INTRINSIC
low complexity region 250 265 N/A INTRINSIC
low complexity region 273 296 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151323
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199518
Predicted Effect probably benign
Transcript: ENSMUST00000169390
SMART Domains Protein: ENSMUSP00000129704
Gene: ENSMUSG00000029326

DomainStartEndE-ValueType
Pfam:HAD_2 13 227 2.6e-23 PFAM
Meta Mutation Damage Score 0.1052 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the subfamily of ubiquitously expressed heterogeneous nuclear ribonucleoproteins (hnRNPs). The hnRNPs are RNA binding proteins and they complex with heterogeneous nuclear RNA (hnRNA). These proteins are associated with pre-mRNAs in the nucleus and appear to influence pre-mRNA processing and other aspects of mRNA metabolism and transport. While all of the hnRNPs are present in the nucleus, some seem to shuttle between the nucleus and the cytoplasm. The hnRNP proteins have distinct nucleic acid binding properties. The protein encoded by this gene has two RRM domains that bind to RNAs. Three alternatively spliced transcript variants have been described for this gene. One of the variants is probably not translated because the transcript is a candidate for nonsense-mediated mRNA decay. The protein isoforms encoded by this gene are similar to its family member HNRPD. [provided by RefSeq, May 2011]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik T C 1: 11,868,752 (GRCm39) I344T probably benign Het
Adamts19 G A 18: 59,101,846 (GRCm39) A639T probably benign Het
Adamts9 T C 6: 92,866,930 (GRCm39) D122G probably damaging Het
Bin2 A G 15: 100,543,029 (GRCm39) S358P possibly damaging Het
Bora A T 14: 99,299,730 (GRCm39) Q234L possibly damaging Het
Btaf1 C T 19: 36,960,942 (GRCm39) R772C probably damaging Het
Cenpf T C 1: 189,390,301 (GRCm39) E1177G probably benign Het
Clec4b2 A T 6: 123,181,100 (GRCm39) probably null Het
Dedd2 G A 7: 24,910,715 (GRCm39) P154S probably benign Het
Dennd5b A G 6: 148,970,193 (GRCm39) S87P probably damaging Het
Dhx8 C T 11: 101,655,139 (GRCm39) R1050W probably damaging Het
Eif3a T C 19: 60,760,568 (GRCm39) K682R possibly damaging Het
Eif4e2 G T 1: 87,153,956 (GRCm39) probably null Het
Ephb1 T C 9: 101,848,303 (GRCm39) D665G probably damaging Het
Gbp7 G A 3: 142,251,697 (GRCm39) V515M probably benign Het
Hook3 C A 8: 26,600,813 (GRCm39) A32S probably benign Het
Hoxb4 T C 11: 96,209,359 (GRCm39) probably benign Het
Idi1 T A 13: 8,940,506 (GRCm39) Y229* probably null Het
Lpl A T 8: 69,349,301 (GRCm39) I276F probably damaging Het
Ltbp4 T C 7: 27,035,105 (GRCm39) probably benign Het
Mphosph8 A G 14: 56,905,998 (GRCm39) I64V probably damaging Het
Mroh1 A G 15: 76,314,423 (GRCm39) D700G probably benign Het
Myt1l G A 12: 29,882,331 (GRCm39) G509R unknown Het
Myt1l T C 12: 29,892,518 (GRCm39) Y52H probably damaging Het
Nlrp9a T A 7: 26,267,402 (GRCm39) D777E probably benign Het
Nudt4 A G 10: 95,387,318 (GRCm39) I82T probably benign Het
Nwd2 T C 5: 63,962,374 (GRCm39) C653R possibly damaging Het
Obscn A G 11: 58,890,393 (GRCm39) Y7380H unknown Het
Or13a18 A G 7: 140,190,594 (GRCm39) T172A probably benign Het
Or8b3b C A 9: 38,583,866 (GRCm39) R291S probably damaging Het
Or8j3 A C 2: 86,028,661 (GRCm39) V145G probably damaging Het
Or8s8 C T 15: 98,354,647 (GRCm39) A152V probably damaging Het
Ptk2 A T 15: 73,148,714 (GRCm39) M409K probably damaging Het
Ptpn11 T C 5: 121,292,589 (GRCm39) T253A probably benign Het
Rabl6 C T 2: 25,473,837 (GRCm39) probably benign Het
Rnf14 T C 18: 38,434,723 (GRCm39) S57P possibly damaging Het
Scnm1 T C 3: 95,037,596 (GRCm39) I157V probably benign Het
Slco1b2 A C 6: 141,609,396 (GRCm39) I269L probably benign Het
Smchd1 A G 17: 71,656,714 (GRCm39) Y1918H probably benign Het
Spag17 A T 3: 100,031,501 (GRCm39) I2255F possibly damaging Het
Spata31g1 A G 4: 42,972,511 (GRCm39) M615V probably benign Het
Tnnt2 A G 1: 135,777,172 (GRCm39) M199V probably benign Het
Tymp GC GCC 15: 89,258,567 (GRCm39) probably null Het
Vmn2r73 T A 7: 85,507,429 (GRCm39) I628L probably benign Het
Zc2hc1b C A 10: 13,047,055 (GRCm39) E19* probably null Het
Other mutations in Hnrnpdl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02751:Hnrnpdl APN 5 100,185,833 (GRCm39) missense probably damaging 1.00
IGL02981:Hnrnpdl APN 5 100,184,958 (GRCm39) missense possibly damaging 0.75
IGL03087:Hnrnpdl APN 5 100,185,460 (GRCm39) missense probably damaging 1.00
R4756:Hnrnpdl UTSW 5 100,185,783 (GRCm39) nonsense probably null
R4812:Hnrnpdl UTSW 5 100,184,331 (GRCm39) unclassified probably benign
R5154:Hnrnpdl UTSW 5 100,184,371 (GRCm39) nonsense probably null
R6086:Hnrnpdl UTSW 5 100,184,340 (GRCm39) missense probably null 1.00
R6143:Hnrnpdl UTSW 5 100,184,410 (GRCm39) nonsense probably null
R6305:Hnrnpdl UTSW 5 100,186,517 (GRCm39) unclassified probably benign
R6807:Hnrnpdl UTSW 5 100,186,995 (GRCm39) missense probably null
R7309:Hnrnpdl UTSW 5 100,185,482 (GRCm39) nonsense probably null
R7449:Hnrnpdl UTSW 5 100,185,014 (GRCm39) missense probably damaging 0.99
R8098:Hnrnpdl UTSW 5 100,185,779 (GRCm39) missense probably benign 0.05
R8922:Hnrnpdl UTSW 5 100,184,419 (GRCm39) nonsense probably null
X0020:Hnrnpdl UTSW 5 100,184,428 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CCTGTGGAAAGGATATGAGTTTCAC -3'
(R):5'- TCAGGTCAGGGCCAAAACTG -3'

Sequencing Primer
(F):5'- CCCTATAAGAAACTATGCATGCTG -3'
(R):5'- GTCAGGGCCAAAACTGGAACC -3'
Posted On 2017-07-14