Incidental Mutation 'R6082:Dennd5b'
ID 482236
Institutional Source Beutler Lab
Gene Symbol Dennd5b
Ensembl Gene ENSMUSG00000030313
Gene Name DENN domain containing 5B
Synonyms D030011O10Rik, 9330160C06Rik
MMRRC Submission 044241-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.131) question?
Stock # R6082 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 148889569-149003178 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 148970193 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 87 (S87P)
Ref Sequence ENSEMBL: ENSMUSP00000107182 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111557] [ENSMUST00000127727] [ENSMUST00000145555]
AlphaFold A2RSQ0
Predicted Effect probably damaging
Transcript: ENSMUST00000111557
AA Change: S87P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000107182
Gene: ENSMUSG00000030313
AA Change: S87P

DomainStartEndE-ValueType
uDENN 18 120 9.96e-39 SMART
low complexity region 145 161 N/A INTRINSIC
DENN 187 375 2.97e-78 SMART
dDENN 498 574 5.92e-23 SMART
RUN 866 929 2.13e-22 SMART
Pfam:PLAT 938 1043 1.7e-12 PFAM
low complexity region 1070 1081 N/A INTRINSIC
RUN 1205 1265 8.42e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000121283
Predicted Effect probably damaging
Transcript: ENSMUST00000127727
AA Change: S109P

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000123568
Gene: ENSMUSG00000030313
AA Change: S109P

DomainStartEndE-ValueType
uDENN 18 142 5.45e-45 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000145555
AA Change: S9P

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000127731
Gene: ENSMUSG00000030313
AA Change: S9P

DomainStartEndE-ValueType
uDENN 1 42 3.03e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150436
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit normal blood lymphocyte populations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik T C 1: 11,868,752 (GRCm39) I344T probably benign Het
Adamts19 G A 18: 59,101,846 (GRCm39) A639T probably benign Het
Adamts9 T C 6: 92,866,930 (GRCm39) D122G probably damaging Het
Bin2 A G 15: 100,543,029 (GRCm39) S358P possibly damaging Het
Bora A T 14: 99,299,730 (GRCm39) Q234L possibly damaging Het
Btaf1 C T 19: 36,960,942 (GRCm39) R772C probably damaging Het
Cenpf T C 1: 189,390,301 (GRCm39) E1177G probably benign Het
Clec4b2 A T 6: 123,181,100 (GRCm39) probably null Het
Dedd2 G A 7: 24,910,715 (GRCm39) P154S probably benign Het
Dhx8 C T 11: 101,655,139 (GRCm39) R1050W probably damaging Het
Eif3a T C 19: 60,760,568 (GRCm39) K682R possibly damaging Het
Eif4e2 G T 1: 87,153,956 (GRCm39) probably null Het
Ephb1 T C 9: 101,848,303 (GRCm39) D665G probably damaging Het
Gbp7 G A 3: 142,251,697 (GRCm39) V515M probably benign Het
Hnrnpdl C T 5: 100,184,340 (GRCm39) G398S probably null Het
Hook3 C A 8: 26,600,813 (GRCm39) A32S probably benign Het
Hoxb4 T C 11: 96,209,359 (GRCm39) probably benign Het
Idi1 T A 13: 8,940,506 (GRCm39) Y229* probably null Het
Lpl A T 8: 69,349,301 (GRCm39) I276F probably damaging Het
Ltbp4 T C 7: 27,035,105 (GRCm39) probably benign Het
Mphosph8 A G 14: 56,905,998 (GRCm39) I64V probably damaging Het
Mroh1 A G 15: 76,314,423 (GRCm39) D700G probably benign Het
Myt1l G A 12: 29,882,331 (GRCm39) G509R unknown Het
Myt1l T C 12: 29,892,518 (GRCm39) Y52H probably damaging Het
Nlrp9a T A 7: 26,267,402 (GRCm39) D777E probably benign Het
Nudt4 A G 10: 95,387,318 (GRCm39) I82T probably benign Het
Nwd2 T C 5: 63,962,374 (GRCm39) C653R possibly damaging Het
Obscn A G 11: 58,890,393 (GRCm39) Y7380H unknown Het
Or13a18 A G 7: 140,190,594 (GRCm39) T172A probably benign Het
Or8b3b C A 9: 38,583,866 (GRCm39) R291S probably damaging Het
Or8j3 A C 2: 86,028,661 (GRCm39) V145G probably damaging Het
Or8s8 C T 15: 98,354,647 (GRCm39) A152V probably damaging Het
Ptk2 A T 15: 73,148,714 (GRCm39) M409K probably damaging Het
Ptpn11 T C 5: 121,292,589 (GRCm39) T253A probably benign Het
Rabl6 C T 2: 25,473,837 (GRCm39) probably benign Het
Rnf14 T C 18: 38,434,723 (GRCm39) S57P possibly damaging Het
Scnm1 T C 3: 95,037,596 (GRCm39) I157V probably benign Het
Slco1b2 A C 6: 141,609,396 (GRCm39) I269L probably benign Het
Smchd1 A G 17: 71,656,714 (GRCm39) Y1918H probably benign Het
Spag17 A T 3: 100,031,501 (GRCm39) I2255F possibly damaging Het
Spata31g1 A G 4: 42,972,511 (GRCm39) M615V probably benign Het
Tnnt2 A G 1: 135,777,172 (GRCm39) M199V probably benign Het
Tymp GC GCC 15: 89,258,567 (GRCm39) probably null Het
Vmn2r73 T A 7: 85,507,429 (GRCm39) I628L probably benign Het
Zc2hc1b C A 10: 13,047,055 (GRCm39) E19* probably null Het
Other mutations in Dennd5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Dennd5b APN 6 148,928,828 (GRCm39) missense probably damaging 1.00
IGL00590:Dennd5b APN 6 148,969,806 (GRCm39) missense probably benign 0.03
IGL00727:Dennd5b APN 6 148,908,214 (GRCm39) splice site probably benign
IGL00838:Dennd5b APN 6 148,906,861 (GRCm39) splice site probably benign
IGL01115:Dennd5b APN 6 148,911,246 (GRCm39) splice site probably benign
IGL01150:Dennd5b APN 6 148,969,583 (GRCm39) missense probably benign 0.01
IGL01873:Dennd5b APN 6 148,946,027 (GRCm39) missense probably benign
IGL01991:Dennd5b APN 6 148,982,322 (GRCm39) missense probably damaging 1.00
IGL02226:Dennd5b APN 6 148,934,799 (GRCm39) missense probably benign 0.00
IGL02820:Dennd5b APN 6 148,920,840 (GRCm39) missense probably null 0.51
IGL03056:Dennd5b APN 6 148,956,570 (GRCm39) missense probably damaging 1.00
IGL03085:Dennd5b APN 6 148,928,893 (GRCm39) missense probably damaging 1.00
IGL03329:Dennd5b APN 6 148,899,758 (GRCm39) missense possibly damaging 0.53
R0081:Dennd5b UTSW 6 148,895,257 (GRCm39) missense probably benign 0.13
R0617:Dennd5b UTSW 6 148,934,760 (GRCm39) splice site probably benign
R1241:Dennd5b UTSW 6 148,969,988 (GRCm39) missense probably benign 0.06
R1252:Dennd5b UTSW 6 148,945,985 (GRCm39) missense probably damaging 1.00
R1255:Dennd5b UTSW 6 148,943,148 (GRCm39) missense possibly damaging 0.48
R1641:Dennd5b UTSW 6 148,969,703 (GRCm39) missense probably damaging 1.00
R1674:Dennd5b UTSW 6 148,899,782 (GRCm39) missense probably damaging 1.00
R1781:Dennd5b UTSW 6 148,928,896 (GRCm39) missense probably damaging 1.00
R1861:Dennd5b UTSW 6 148,969,760 (GRCm39) missense probably damaging 1.00
R1907:Dennd5b UTSW 6 148,943,074 (GRCm39) missense probably benign 0.00
R2412:Dennd5b UTSW 6 148,906,736 (GRCm39) missense possibly damaging 0.88
R3794:Dennd5b UTSW 6 149,002,715 (GRCm39) missense possibly damaging 0.87
R3825:Dennd5b UTSW 6 148,946,334 (GRCm39) missense probably benign
R4581:Dennd5b UTSW 6 148,918,482 (GRCm39) splice site silent
R4654:Dennd5b UTSW 6 148,908,335 (GRCm39) missense probably damaging 1.00
R4725:Dennd5b UTSW 6 148,946,277 (GRCm39) missense probably damaging 0.97
R4981:Dennd5b UTSW 6 148,911,270 (GRCm39) missense possibly damaging 0.88
R4994:Dennd5b UTSW 6 148,942,998 (GRCm39) splice site probably null
R5400:Dennd5b UTSW 6 148,901,514 (GRCm39) missense probably damaging 1.00
R5452:Dennd5b UTSW 6 148,943,011 (GRCm39) splice site probably null
R5548:Dennd5b UTSW 6 148,920,847 (GRCm39) splice site probably null
R5841:Dennd5b UTSW 6 148,946,253 (GRCm39) missense probably benign 0.11
R5996:Dennd5b UTSW 6 148,969,593 (GRCm39) missense probably benign 0.22
R6556:Dennd5b UTSW 6 148,915,749 (GRCm39) splice site probably null
R6812:Dennd5b UTSW 6 148,982,630 (GRCm39) start gained probably benign
R6828:Dennd5b UTSW 6 148,895,244 (GRCm39) missense probably damaging 0.99
R7104:Dennd5b UTSW 6 148,946,102 (GRCm39) missense probably damaging 1.00
R7231:Dennd5b UTSW 6 148,946,102 (GRCm39) missense probably damaging 1.00
R7325:Dennd5b UTSW 6 148,922,068 (GRCm39) missense probably benign 0.00
R7399:Dennd5b UTSW 6 148,937,981 (GRCm39) missense probably damaging 1.00
R7516:Dennd5b UTSW 6 148,969,878 (GRCm39) missense probably benign 0.02
R7751:Dennd5b UTSW 6 148,918,604 (GRCm39) missense probably benign 0.01
R7763:Dennd5b UTSW 6 148,970,156 (GRCm39) missense probably damaging 1.00
R7770:Dennd5b UTSW 6 148,943,214 (GRCm39) missense probably damaging 0.99
R7788:Dennd5b UTSW 6 148,970,064 (GRCm39) missense probably benign 0.00
R7854:Dennd5b UTSW 6 148,969,964 (GRCm39) missense probably benign 0.00
R7899:Dennd5b UTSW 6 148,943,159 (GRCm39) missense probably damaging 1.00
R8226:Dennd5b UTSW 6 148,915,746 (GRCm39) splice site probably null
R8328:Dennd5b UTSW 6 148,922,115 (GRCm39) missense probably damaging 1.00
R8489:Dennd5b UTSW 6 148,986,389 (GRCm39) missense probably benign 0.00
R8517:Dennd5b UTSW 6 148,930,619 (GRCm39) missense probably damaging 1.00
R8556:Dennd5b UTSW 6 148,895,268 (GRCm39) missense probably damaging 1.00
R8693:Dennd5b UTSW 6 148,911,272 (GRCm39) nonsense probably null
R8946:Dennd5b UTSW 6 148,943,485 (GRCm39) intron probably benign
R8966:Dennd5b UTSW 6 148,901,474 (GRCm39) missense probably damaging 1.00
R9122:Dennd5b UTSW 6 148,908,240 (GRCm39) missense
R9178:Dennd5b UTSW 6 148,934,844 (GRCm39) nonsense probably null
R9208:Dennd5b UTSW 6 149,002,698 (GRCm39) missense probably benign 0.09
R9465:Dennd5b UTSW 6 148,908,260 (GRCm39) missense probably damaging 1.00
R9535:Dennd5b UTSW 6 148,895,365 (GRCm39) missense probably benign 0.03
R9541:Dennd5b UTSW 6 148,899,872 (GRCm39) missense probably benign 0.00
R9731:Dennd5b UTSW 6 148,970,138 (GRCm39) missense probably damaging 1.00
R9760:Dennd5b UTSW 6 148,969,997 (GRCm39) missense probably benign 0.14
R9783:Dennd5b UTSW 6 148,911,342 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACACTGCTGTACTGCTCAG -3'
(R):5'- AGGGAAGAGCTTACACTACGTTTC -3'

Sequencing Primer
(F):5'- CTGTACTGCTCAGCATTATGC -3'
(R):5'- GTGGCTCATGACCATCTGTAACAG -3'
Posted On 2017-07-14