Incidental Mutation 'R6082:Dedd2'
ID 482237
Institutional Source Beutler Lab
Gene Symbol Dedd2
Ensembl Gene ENSMUSG00000054499
Gene Name death effector domain-containing DNA binding protein 2
Synonyms FLAME-3, 2410050E11Rik
MMRRC Submission 044241-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.122) question?
Stock # R6082 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 24899337-24920035 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 24910715 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 154 (P154S)
Ref Sequence ENSEMBL: ENSMUSP00000146052 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058702] [ENSMUST00000205271]
AlphaFold Q8QZV0
Predicted Effect probably benign
Transcript: ENSMUST00000058702
AA Change: P154S

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000049763
Gene: ENSMUSG00000054499
AA Change: P154S

DomainStartEndE-ValueType
DED 24 104 6.34e-13 SMART
low complexity region 130 147 N/A INTRINSIC
low complexity region 157 182 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205271
AA Change: P154S

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206750
Meta Mutation Damage Score 0.0645 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear-localized protein containing a death effector domain (DED). The encoded protein may regulate the trafficking of caspases and other proteins into the nucleus during death receptor-induced apoptosis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik T C 1: 11,868,752 (GRCm39) I344T probably benign Het
Adamts19 G A 18: 59,101,846 (GRCm39) A639T probably benign Het
Adamts9 T C 6: 92,866,930 (GRCm39) D122G probably damaging Het
Bin2 A G 15: 100,543,029 (GRCm39) S358P possibly damaging Het
Bora A T 14: 99,299,730 (GRCm39) Q234L possibly damaging Het
Btaf1 C T 19: 36,960,942 (GRCm39) R772C probably damaging Het
Cenpf T C 1: 189,390,301 (GRCm39) E1177G probably benign Het
Clec4b2 A T 6: 123,181,100 (GRCm39) probably null Het
Dennd5b A G 6: 148,970,193 (GRCm39) S87P probably damaging Het
Dhx8 C T 11: 101,655,139 (GRCm39) R1050W probably damaging Het
Eif3a T C 19: 60,760,568 (GRCm39) K682R possibly damaging Het
Eif4e2 G T 1: 87,153,956 (GRCm39) probably null Het
Ephb1 T C 9: 101,848,303 (GRCm39) D665G probably damaging Het
Gbp7 G A 3: 142,251,697 (GRCm39) V515M probably benign Het
Hnrnpdl C T 5: 100,184,340 (GRCm39) G398S probably null Het
Hook3 C A 8: 26,600,813 (GRCm39) A32S probably benign Het
Hoxb4 T C 11: 96,209,359 (GRCm39) probably benign Het
Idi1 T A 13: 8,940,506 (GRCm39) Y229* probably null Het
Lpl A T 8: 69,349,301 (GRCm39) I276F probably damaging Het
Ltbp4 T C 7: 27,035,105 (GRCm39) probably benign Het
Mphosph8 A G 14: 56,905,998 (GRCm39) I64V probably damaging Het
Mroh1 A G 15: 76,314,423 (GRCm39) D700G probably benign Het
Myt1l G A 12: 29,882,331 (GRCm39) G509R unknown Het
Myt1l T C 12: 29,892,518 (GRCm39) Y52H probably damaging Het
Nlrp9a T A 7: 26,267,402 (GRCm39) D777E probably benign Het
Nudt4 A G 10: 95,387,318 (GRCm39) I82T probably benign Het
Nwd2 T C 5: 63,962,374 (GRCm39) C653R possibly damaging Het
Obscn A G 11: 58,890,393 (GRCm39) Y7380H unknown Het
Or13a18 A G 7: 140,190,594 (GRCm39) T172A probably benign Het
Or8b3b C A 9: 38,583,866 (GRCm39) R291S probably damaging Het
Or8j3 A C 2: 86,028,661 (GRCm39) V145G probably damaging Het
Or8s8 C T 15: 98,354,647 (GRCm39) A152V probably damaging Het
Ptk2 A T 15: 73,148,714 (GRCm39) M409K probably damaging Het
Ptpn11 T C 5: 121,292,589 (GRCm39) T253A probably benign Het
Rabl6 C T 2: 25,473,837 (GRCm39) probably benign Het
Rnf14 T C 18: 38,434,723 (GRCm39) S57P possibly damaging Het
Scnm1 T C 3: 95,037,596 (GRCm39) I157V probably benign Het
Slco1b2 A C 6: 141,609,396 (GRCm39) I269L probably benign Het
Smchd1 A G 17: 71,656,714 (GRCm39) Y1918H probably benign Het
Spag17 A T 3: 100,031,501 (GRCm39) I2255F possibly damaging Het
Spata31g1 A G 4: 42,972,511 (GRCm39) M615V probably benign Het
Tnnt2 A G 1: 135,777,172 (GRCm39) M199V probably benign Het
Tymp GC GCC 15: 89,258,567 (GRCm39) probably null Het
Vmn2r73 T A 7: 85,507,429 (GRCm39) I628L probably benign Het
Zc2hc1b C A 10: 13,047,055 (GRCm39) E19* probably null Het
Other mutations in Dedd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0346:Dedd2 UTSW 7 24,910,694 (GRCm39) missense possibly damaging 0.46
R0480:Dedd2 UTSW 7 24,903,050 (GRCm39) missense probably damaging 1.00
R0838:Dedd2 UTSW 7 24,910,612 (GRCm39) missense probably benign 0.10
R5000:Dedd2 UTSW 7 24,903,068 (GRCm39) missense possibly damaging 0.91
R5085:Dedd2 UTSW 7 24,918,411 (GRCm39) missense probably damaging 1.00
R6083:Dedd2 UTSW 7 24,910,715 (GRCm39) missense probably benign 0.02
R6084:Dedd2 UTSW 7 24,910,715 (GRCm39) missense probably benign 0.02
R6264:Dedd2 UTSW 7 24,903,215 (GRCm39) missense possibly damaging 0.84
R6646:Dedd2 UTSW 7 24,903,038 (GRCm39) missense probably damaging 1.00
R6733:Dedd2 UTSW 7 24,903,332 (GRCm39) missense probably benign 0.30
R7267:Dedd2 UTSW 7 24,918,391 (GRCm39) missense probably damaging 0.99
R8465:Dedd2 UTSW 7 24,918,331 (GRCm39) missense probably damaging 0.99
R8807:Dedd2 UTSW 7 24,910,705 (GRCm39) missense probably benign 0.01
R9068:Dedd2 UTSW 7 24,917,092 (GRCm39) missense probably benign
Z1176:Dedd2 UTSW 7 24,903,023 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCATAGGCACTTTACAGCGTTC -3'
(R):5'- TAGATGGCAGTTGTCAAGCC -3'

Sequencing Primer
(F):5'- AGGCACTTTACAGCGTTCTCAAG -3'
(R):5'- GGCAGTTGTCAAGCCTGTCTC -3'
Posted On 2017-07-14