Incidental Mutation 'R6082:Nlrp9a'
ID 482238
Institutional Source Beutler Lab
Gene Symbol Nlrp9a
Ensembl Gene ENSMUSG00000054102
Gene Name NLR family, pyrin domain containing 9A
Synonyms Nalp9a, Nalp-theta, D7Ertd565e
MMRRC Submission 044241-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.070) question?
Stock # R6082 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 26234448-26273573 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 26267402 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 777 (D777E)
Ref Sequence ENSEMBL: ENSMUSP00000113318 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071780] [ENSMUST00000108387] [ENSMUST00000117252] [ENSMUST00000122040] [ENSMUST00000153452]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000071780
AA Change: D777E

PolyPhen 2 Score 0.415 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000071685
Gene: ENSMUSG00000054102
AA Change: D777E

DomainStartEndE-ValueType
PYRIN 5 87 1.07e-25 SMART
Pfam:NACHT 143 311 1e-32 PFAM
LRR 637 664 1.42e0 SMART
LRR 693 720 2.32e-1 SMART
LRR 722 749 3e0 SMART
LRR 750 777 1.12e-3 SMART
LRR 779 806 2.17e0 SMART
LRR 807 834 2.27e-4 SMART
LRR 836 863 2.02e2 SMART
LRR 864 891 6.24e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108387
AA Change: D832E

PolyPhen 2 Score 0.415 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000104024
Gene: ENSMUSG00000054102
AA Change: D832E

DomainStartEndE-ValueType
PYRIN 5 87 1.07e-25 SMART
Pfam:NACHT 143 311 7.7e-33 PFAM
LRR 631 658 1.42e0 SMART
LRR 692 719 1.42e0 SMART
LRR 748 775 2.32e-1 SMART
LRR 777 804 3e0 SMART
LRR 805 832 1.12e-3 SMART
LRR 834 861 2.17e0 SMART
LRR 862 889 2.27e-4 SMART
LRR 891 918 2.02e2 SMART
LRR 919 946 6.24e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117252
AA Change: D777E

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000112398
Gene: ENSMUSG00000054102
AA Change: D777E

DomainStartEndE-ValueType
PYRIN 5 87 1.07e-25 SMART
Pfam:NACHT 143 311 8.8e-34 PFAM
LRR 637 664 1.42e0 SMART
Blast:LRR 666 692 1e-5 BLAST
LRR 693 720 2.32e-1 SMART
LRR 722 749 3e0 SMART
LRR 750 777 1.12e-3 SMART
LRR 779 806 2.39e0 SMART
LRR 807 834 6.24e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122040
AA Change: D777E

PolyPhen 2 Score 0.415 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000113318
Gene: ENSMUSG00000054102
AA Change: D777E

DomainStartEndE-ValueType
PYRIN 5 87 1.07e-25 SMART
Pfam:NACHT 143 311 1e-32 PFAM
LRR 637 664 1.42e0 SMART
LRR 693 720 2.32e-1 SMART
LRR 722 749 3e0 SMART
LRR 750 777 1.12e-3 SMART
LRR 779 806 2.17e0 SMART
LRR 807 834 2.27e-4 SMART
LRR 836 863 2.02e2 SMART
LRR 864 891 6.24e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143149
Predicted Effect probably benign
Transcript: ENSMUST00000153452
AA Change: D743E

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000120498
Gene: ENSMUSG00000054102
AA Change: D743E

DomainStartEndE-ValueType
Pfam:NACHT 54 222 6.9e-33 PFAM
LRR 542 569 1.42e0 SMART
LRR 603 630 1.42e0 SMART
Blast:LRR 632 657 1e-5 BLAST
LRR 659 686 2.32e-1 SMART
LRR 688 715 3e0 SMART
LRR 716 743 1.12e-3 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik T C 1: 11,868,752 (GRCm39) I344T probably benign Het
Adamts19 G A 18: 59,101,846 (GRCm39) A639T probably benign Het
Adamts9 T C 6: 92,866,930 (GRCm39) D122G probably damaging Het
Bin2 A G 15: 100,543,029 (GRCm39) S358P possibly damaging Het
Bora A T 14: 99,299,730 (GRCm39) Q234L possibly damaging Het
Btaf1 C T 19: 36,960,942 (GRCm39) R772C probably damaging Het
Cenpf T C 1: 189,390,301 (GRCm39) E1177G probably benign Het
Clec4b2 A T 6: 123,181,100 (GRCm39) probably null Het
Dedd2 G A 7: 24,910,715 (GRCm39) P154S probably benign Het
Dennd5b A G 6: 148,970,193 (GRCm39) S87P probably damaging Het
Dhx8 C T 11: 101,655,139 (GRCm39) R1050W probably damaging Het
Eif3a T C 19: 60,760,568 (GRCm39) K682R possibly damaging Het
Eif4e2 G T 1: 87,153,956 (GRCm39) probably null Het
Ephb1 T C 9: 101,848,303 (GRCm39) D665G probably damaging Het
Gbp7 G A 3: 142,251,697 (GRCm39) V515M probably benign Het
Hnrnpdl C T 5: 100,184,340 (GRCm39) G398S probably null Het
Hook3 C A 8: 26,600,813 (GRCm39) A32S probably benign Het
Hoxb4 T C 11: 96,209,359 (GRCm39) probably benign Het
Idi1 T A 13: 8,940,506 (GRCm39) Y229* probably null Het
Lpl A T 8: 69,349,301 (GRCm39) I276F probably damaging Het
Ltbp4 T C 7: 27,035,105 (GRCm39) probably benign Het
Mphosph8 A G 14: 56,905,998 (GRCm39) I64V probably damaging Het
Mroh1 A G 15: 76,314,423 (GRCm39) D700G probably benign Het
Myt1l G A 12: 29,882,331 (GRCm39) G509R unknown Het
Myt1l T C 12: 29,892,518 (GRCm39) Y52H probably damaging Het
Nudt4 A G 10: 95,387,318 (GRCm39) I82T probably benign Het
Nwd2 T C 5: 63,962,374 (GRCm39) C653R possibly damaging Het
Obscn A G 11: 58,890,393 (GRCm39) Y7380H unknown Het
Or13a18 A G 7: 140,190,594 (GRCm39) T172A probably benign Het
Or8b3b C A 9: 38,583,866 (GRCm39) R291S probably damaging Het
Or8j3 A C 2: 86,028,661 (GRCm39) V145G probably damaging Het
Or8s8 C T 15: 98,354,647 (GRCm39) A152V probably damaging Het
Ptk2 A T 15: 73,148,714 (GRCm39) M409K probably damaging Het
Ptpn11 T C 5: 121,292,589 (GRCm39) T253A probably benign Het
Rabl6 C T 2: 25,473,837 (GRCm39) probably benign Het
Rnf14 T C 18: 38,434,723 (GRCm39) S57P possibly damaging Het
Scnm1 T C 3: 95,037,596 (GRCm39) I157V probably benign Het
Slco1b2 A C 6: 141,609,396 (GRCm39) I269L probably benign Het
Smchd1 A G 17: 71,656,714 (GRCm39) Y1918H probably benign Het
Spag17 A T 3: 100,031,501 (GRCm39) I2255F possibly damaging Het
Spata31g1 A G 4: 42,972,511 (GRCm39) M615V probably benign Het
Tnnt2 A G 1: 135,777,172 (GRCm39) M199V probably benign Het
Tymp GC GCC 15: 89,258,567 (GRCm39) probably null Het
Vmn2r73 T A 7: 85,507,429 (GRCm39) I628L probably benign Het
Zc2hc1b C A 10: 13,047,055 (GRCm39) E19* probably null Het
Other mutations in Nlrp9a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00659:Nlrp9a APN 7 26,257,050 (GRCm39) missense probably benign 0.22
IGL00895:Nlrp9a APN 7 26,258,103 (GRCm39) missense probably benign
IGL01081:Nlrp9a APN 7 26,257,519 (GRCm39) missense possibly damaging 0.51
IGL01148:Nlrp9a APN 7 26,257,006 (GRCm39) missense probably damaging 1.00
IGL01368:Nlrp9a APN 7 26,257,299 (GRCm39) missense probably damaging 1.00
IGL01914:Nlrp9a APN 7 26,256,689 (GRCm39) missense probably benign 0.01
IGL01952:Nlrp9a APN 7 26,257,444 (GRCm39) missense probably benign 0.01
IGL02245:Nlrp9a APN 7 26,257,318 (GRCm39) missense probably benign 0.02
IGL02449:Nlrp9a APN 7 26,264,396 (GRCm39) missense probably benign 0.00
IGL02702:Nlrp9a APN 7 26,264,381 (GRCm39) missense possibly damaging 0.67
IGL02944:Nlrp9a APN 7 26,258,076 (GRCm39) missense probably benign 0.28
IGL03183:Nlrp9a APN 7 26,256,882 (GRCm39) missense probably damaging 1.00
R0005:Nlrp9a UTSW 7 26,273,213 (GRCm39) splice site probably benign
R0007:Nlrp9a UTSW 7 26,250,515 (GRCm39) intron probably benign
R0007:Nlrp9a UTSW 7 26,250,515 (GRCm39) intron probably benign
R0013:Nlrp9a UTSW 7 26,270,650 (GRCm39) splice site probably null
R0086:Nlrp9a UTSW 7 26,257,972 (GRCm39) missense probably damaging 0.98
R0659:Nlrp9a UTSW 7 26,256,703 (GRCm39) missense probably damaging 1.00
R1126:Nlrp9a UTSW 7 26,260,166 (GRCm39) missense probably benign 0.12
R1500:Nlrp9a UTSW 7 26,267,316 (GRCm39) missense probably benign 0.01
R1585:Nlrp9a UTSW 7 26,258,093 (GRCm39) missense probably benign 0.41
R1594:Nlrp9a UTSW 7 26,269,932 (GRCm39) nonsense probably null
R1968:Nlrp9a UTSW 7 26,264,366 (GRCm39) missense probably benign 0.23
R1989:Nlrp9a UTSW 7 26,273,338 (GRCm39) missense probably benign 0.24
R2057:Nlrp9a UTSW 7 26,256,787 (GRCm39) missense possibly damaging 0.55
R2058:Nlrp9a UTSW 7 26,256,787 (GRCm39) missense possibly damaging 0.55
R2059:Nlrp9a UTSW 7 26,256,787 (GRCm39) missense possibly damaging 0.55
R2188:Nlrp9a UTSW 7 26,264,354 (GRCm39) missense probably damaging 1.00
R2318:Nlrp9a UTSW 7 26,273,277 (GRCm39) missense probably damaging 0.98
R3110:Nlrp9a UTSW 7 26,257,297 (GRCm39) missense probably benign 0.08
R3112:Nlrp9a UTSW 7 26,257,297 (GRCm39) missense probably benign 0.08
R3237:Nlrp9a UTSW 7 26,270,810 (GRCm39) nonsense probably null
R3545:Nlrp9a UTSW 7 26,256,757 (GRCm39) missense probably benign 0.03
R3805:Nlrp9a UTSW 7 26,264,277 (GRCm39) nonsense probably null
R4005:Nlrp9a UTSW 7 26,257,975 (GRCm39) missense probably benign 0.02
R4057:Nlrp9a UTSW 7 26,270,071 (GRCm39) missense probably benign 0.00
R4529:Nlrp9a UTSW 7 26,270,832 (GRCm39) missense probably damaging 1.00
R4756:Nlrp9a UTSW 7 26,256,866 (GRCm39) missense probably damaging 1.00
R4908:Nlrp9a UTSW 7 26,250,369 (GRCm39) missense probably damaging 1.00
R4972:Nlrp9a UTSW 7 26,269,964 (GRCm39) missense probably damaging 1.00
R4992:Nlrp9a UTSW 7 26,256,811 (GRCm39) missense probably benign 0.00
R5042:Nlrp9a UTSW 7 26,270,703 (GRCm39) missense probably damaging 1.00
R5224:Nlrp9a UTSW 7 26,256,717 (GRCm39) missense probably benign 0.43
R5449:Nlrp9a UTSW 7 26,257,254 (GRCm39) missense probably benign 0.04
R5644:Nlrp9a UTSW 7 26,257,993 (GRCm39) missense possibly damaging 0.51
R5734:Nlrp9a UTSW 7 26,270,065 (GRCm39) missense probably damaging 1.00
R5905:Nlrp9a UTSW 7 26,257,762 (GRCm39) missense probably benign 0.02
R5978:Nlrp9a UTSW 7 26,256,703 (GRCm39) missense probably damaging 1.00
R6028:Nlrp9a UTSW 7 26,257,762 (GRCm39) missense probably benign 0.02
R6066:Nlrp9a UTSW 7 26,257,510 (GRCm39) missense probably benign 0.00
R6171:Nlrp9a UTSW 7 26,258,188 (GRCm39) missense possibly damaging 0.71
R6352:Nlrp9a UTSW 7 26,257,051 (GRCm39) missense probably damaging 1.00
R6490:Nlrp9a UTSW 7 26,250,311 (GRCm39) missense probably damaging 1.00
R6540:Nlrp9a UTSW 7 26,256,817 (GRCm39) missense possibly damaging 0.88
R7039:Nlrp9a UTSW 7 26,267,367 (GRCm39) missense probably benign 0.03
R7151:Nlrp9a UTSW 7 26,256,672 (GRCm39) nonsense probably null
R7173:Nlrp9a UTSW 7 26,257,603 (GRCm39) missense probably benign 0.00
R7214:Nlrp9a UTSW 7 26,250,463 (GRCm39) missense probably damaging 0.98
R7226:Nlrp9a UTSW 7 26,258,149 (GRCm39) missense probably benign 0.02
R7250:Nlrp9a UTSW 7 26,258,143 (GRCm39) missense possibly damaging 0.78
R7293:Nlrp9a UTSW 7 26,270,694 (GRCm39) missense probably damaging 1.00
R7492:Nlrp9a UTSW 7 26,257,081 (GRCm39) missense probably damaging 0.99
R7586:Nlrp9a UTSW 7 26,256,721 (GRCm39) missense possibly damaging 0.83
R7844:Nlrp9a UTSW 7 26,262,006 (GRCm39) missense possibly damaging 0.82
R8073:Nlrp9a UTSW 7 26,260,260 (GRCm39) missense probably damaging 0.98
R8136:Nlrp9a UTSW 7 26,256,678 (GRCm39) missense probably benign 0.34
R8400:Nlrp9a UTSW 7 26,264,431 (GRCm39) missense probably benign 0.02
R8415:Nlrp9a UTSW 7 26,256,925 (GRCm39) missense probably benign
R8774:Nlrp9a UTSW 7 26,257,984 (GRCm39) missense possibly damaging 0.95
R8774-TAIL:Nlrp9a UTSW 7 26,257,984 (GRCm39) missense possibly damaging 0.95
R8882:Nlrp9a UTSW 7 26,257,703 (GRCm39) nonsense probably null
R9023:Nlrp9a UTSW 7 26,273,291 (GRCm39) missense possibly damaging 0.62
R9031:Nlrp9a UTSW 7 26,257,698 (GRCm39) missense probably damaging 1.00
R9063:Nlrp9a UTSW 7 26,273,291 (GRCm39) missense possibly damaging 0.62
R9090:Nlrp9a UTSW 7 26,261,944 (GRCm39) missense probably benign
R9196:Nlrp9a UTSW 7 26,258,158 (GRCm39) missense probably damaging 1.00
R9206:Nlrp9a UTSW 7 26,257,656 (GRCm39) missense possibly damaging 0.91
R9265:Nlrp9a UTSW 7 26,258,038 (GRCm39) missense possibly damaging 0.67
R9271:Nlrp9a UTSW 7 26,261,944 (GRCm39) missense probably benign
R9384:Nlrp9a UTSW 7 26,258,158 (GRCm39) missense probably damaging 1.00
R9402:Nlrp9a UTSW 7 26,270,030 (GRCm39) missense possibly damaging 0.81
R9424:Nlrp9a UTSW 7 26,260,178 (GRCm39) missense probably benign 0.13
R9620:Nlrp9a UTSW 7 26,250,469 (GRCm39) missense probably damaging 1.00
R9660:Nlrp9a UTSW 7 26,256,915 (GRCm39) missense probably damaging 1.00
R9696:Nlrp9a UTSW 7 26,275,033 (GRCm39) missense unknown
R9728:Nlrp9a UTSW 7 26,256,915 (GRCm39) missense probably damaging 1.00
R9744:Nlrp9a UTSW 7 26,267,266 (GRCm39) missense probably benign 0.07
R9794:Nlrp9a UTSW 7 26,264,302 (GRCm39) missense probably benign 0.03
Z1176:Nlrp9a UTSW 7 26,257,654 (GRCm39) missense probably damaging 1.00
Z1177:Nlrp9a UTSW 7 26,256,881 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTAAGTAAGTTGCTGACATGTGG -3'
(R):5'- AAGCAGTAGTCTCTGGGGACTC -3'

Sequencing Primer
(F):5'- ACATGTGGTCTTCTTTCAGGTTGTC -3'
(R):5'- TGACGACGGACTCCATATCTTAAG -3'
Posted On 2017-07-14