Incidental Mutation 'R6082:Vmn2r73'
ID482240
Institutional Source Beutler Lab
Gene Symbol Vmn2r73
Ensembl Gene ENSMUSG00000070458
Gene Namevomeronasal 2, receptor 73
SynonymsEG620928
MMRRC Submission 044241-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.192) question?
Stock #R6082 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location85857547-85875938 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 85858221 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 628 (I628L)
Ref Sequence ENSEMBL: ENSMUSP00000076687 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077478]
Predicted Effect probably benign
Transcript: ENSMUST00000077478
AA Change: I628L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000076687
Gene: ENSMUSG00000070458
AA Change: I628L

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 77 465 1.4e-30 PFAM
Pfam:NCD3G 508 560 5.9e-21 PFAM
Pfam:7tm_3 590 827 4.4e-51 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A G 4: 42,972,511 M615V probably benign Het
A830018L16Rik T C 1: 11,798,528 I344T probably benign Het
Adamts19 G A 18: 58,968,774 A639T probably benign Het
Adamts9 T C 6: 92,889,949 D122G probably damaging Het
Bin2 A G 15: 100,645,148 S358P possibly damaging Het
Bora A T 14: 99,062,294 Q234L possibly damaging Het
Btaf1 C T 19: 36,983,542 R772C probably damaging Het
Cenpf T C 1: 189,658,104 E1177G probably benign Het
Clec4b2 A T 6: 123,204,141 probably null Het
Dedd2 G A 7: 25,211,290 P154S probably benign Het
Dennd5b A G 6: 149,068,695 S87P probably damaging Het
Dhx8 C T 11: 101,764,313 R1050W probably damaging Het
Eif3a T C 19: 60,772,130 K682R possibly damaging Het
Eif4e2 G T 1: 87,226,234 probably null Het
Ephb1 T C 9: 101,971,104 D665G probably damaging Het
Gbp7 G A 3: 142,545,936 V515M probably benign Het
Hnrnpdl C T 5: 100,036,481 G398S probably null Het
Hook3 C A 8: 26,110,785 A32S probably benign Het
Hoxb4 T C 11: 96,318,533 probably benign Het
Idi1 T A 13: 8,890,470 Y229* probably null Het
Lpl A T 8: 68,896,649 I276F probably damaging Het
Ltbp4 T C 7: 27,335,680 probably benign Het
Mphosph8 A G 14: 56,668,541 I64V probably damaging Het
Mroh1 A G 15: 76,430,223 D700G probably benign Het
Myt1l G A 12: 29,832,332 G509R unknown Het
Myt1l T C 12: 29,842,519 Y52H probably damaging Het
Nlrp9a T A 7: 26,567,977 D777E probably benign Het
Nudt4 A G 10: 95,551,456 I82T probably benign Het
Nwd2 T C 5: 63,805,031 C653R possibly damaging Het
Obscn A G 11: 58,999,567 Y7380H unknown Het
Olfr1045 A C 2: 86,198,317 V145G probably damaging Het
Olfr281 C T 15: 98,456,766 A152V probably damaging Het
Olfr46 A G 7: 140,610,681 T172A probably benign Het
Olfr918 C A 9: 38,672,570 R291S probably damaging Het
Ptk2 A T 15: 73,276,865 M409K probably damaging Het
Ptpn11 T C 5: 121,154,526 T253A probably benign Het
Rabl6 C T 2: 25,583,825 probably benign Het
Rnf14 T C 18: 38,301,670 S57P possibly damaging Het
Scnm1 T C 3: 95,130,285 I157V probably benign Het
Slco1b2 A C 6: 141,663,670 I269L probably benign Het
Smchd1 A G 17: 71,349,719 Y1918H probably benign Het
Spag17 A T 3: 100,124,185 I2255F possibly damaging Het
Tnnt2 A G 1: 135,849,434 M199V probably benign Het
Tymp GC GCC 15: 89,374,364 probably null Het
Zc2hc1b C A 10: 13,171,311 E19* probably null Het
Other mutations in Vmn2r73
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Vmn2r73 APN 7 85857587 missense probably benign
IGL01151:Vmn2r73 APN 7 85857878 missense probably damaging 0.99
IGL01408:Vmn2r73 APN 7 85872247 missense probably benign 0.45
IGL01505:Vmn2r73 APN 7 85858059 nonsense probably null
IGL01731:Vmn2r73 APN 7 85857549 makesense probably null
IGL01818:Vmn2r73 APN 7 85869901 splice site probably benign
IGL02236:Vmn2r73 APN 7 85872694 missense probably benign 0.00
IGL02265:Vmn2r73 APN 7 85871639 missense probably benign 0.02
IGL02266:Vmn2r73 APN 7 85875799 missense possibly damaging 0.52
IGL02276:Vmn2r73 APN 7 85869772 critical splice donor site probably null
IGL02284:Vmn2r73 APN 7 85857915 missense possibly damaging 0.92
IGL02380:Vmn2r73 APN 7 85858175 missense probably benign 0.00
IGL02466:Vmn2r73 APN 7 85872876 missense probably damaging 1.00
IGL03172:Vmn2r73 APN 7 85858287 missense probably benign 0.01
IGL03179:Vmn2r73 APN 7 85870260 missense probably benign 0.04
R0077:Vmn2r73 UTSW 7 85875867 missense probably benign 0.00
R0311:Vmn2r73 UTSW 7 85871789 missense probably benign
R0413:Vmn2r73 UTSW 7 85871879 missense possibly damaging 0.68
R0494:Vmn2r73 UTSW 7 85872932 missense probably benign
R1523:Vmn2r73 UTSW 7 85870278 missense probably benign 0.02
R1618:Vmn2r73 UTSW 7 85875912 nonsense probably null
R1667:Vmn2r73 UTSW 7 85857681 missense probably benign 0.00
R1728:Vmn2r73 UTSW 7 85857878 missense probably damaging 1.00
R1729:Vmn2r73 UTSW 7 85857878 missense probably damaging 1.00
R1747:Vmn2r73 UTSW 7 85858167 missense probably damaging 1.00
R1784:Vmn2r73 UTSW 7 85857878 missense probably damaging 1.00
R2152:Vmn2r73 UTSW 7 85857728 missense probably benign 0.03
R2395:Vmn2r73 UTSW 7 85857767 missense probably damaging 1.00
R2415:Vmn2r73 UTSW 7 85872223 missense probably damaging 1.00
R2926:Vmn2r73 UTSW 7 85871663 missense probably benign 0.17
R3719:Vmn2r73 UTSW 7 85870374 missense probably damaging 1.00
R3766:Vmn2r73 UTSW 7 85871990 missense probably benign
R3838:Vmn2r73 UTSW 7 85858050 missense probably benign 0.00
R3890:Vmn2r73 UTSW 7 85857936 missense probably benign
R4030:Vmn2r73 UTSW 7 85871836 missense possibly damaging 0.92
R4247:Vmn2r73 UTSW 7 85872675 missense probably damaging 0.99
R4409:Vmn2r73 UTSW 7 85871560 missense probably damaging 0.97
R4427:Vmn2r73 UTSW 7 85857773 missense probably damaging 1.00
R4430:Vmn2r73 UTSW 7 85870241 missense probably benign
R4552:Vmn2r73 UTSW 7 85875847 missense probably benign 0.12
R4779:Vmn2r73 UTSW 7 85871715 nonsense probably null
R4906:Vmn2r73 UTSW 7 85857621 missense probably damaging 0.99
R4942:Vmn2r73 UTSW 7 85870374 missense probably damaging 1.00
R5280:Vmn2r73 UTSW 7 85857947 missense probably damaging 0.98
R5344:Vmn2r73 UTSW 7 85875838 missense probably benign 0.00
R5478:Vmn2r73 UTSW 7 85869788 missense probably damaging 1.00
R5527:Vmn2r73 UTSW 7 85858367 missense possibly damaging 0.65
R5691:Vmn2r73 UTSW 7 85858091 missense probably damaging 1.00
R5826:Vmn2r73 UTSW 7 85875748 missense possibly damaging 0.77
R6018:Vmn2r73 UTSW 7 85872667 missense possibly damaging 0.48
R6111:Vmn2r73 UTSW 7 85871789 missense probably benign
R6233:Vmn2r73 UTSW 7 85869891 missense probably benign 0.00
R6278:Vmn2r73 UTSW 7 85872932 missense probably benign
R6283:Vmn2r73 UTSW 7 85871841 missense probably benign 0.00
R6307:Vmn2r73 UTSW 7 85857620 missense probably damaging 1.00
R6413:Vmn2r73 UTSW 7 85870336 nonsense probably null
R6782:Vmn2r73 UTSW 7 85870355 missense probably benign 0.00
R6884:Vmn2r73 UTSW 7 85858005 missense probably benign 0.05
R6921:Vmn2r73 UTSW 7 85858238 missense probably benign 0.27
R7169:Vmn2r73 UTSW 7 85858455 nonsense probably null
R7206:Vmn2r73 UTSW 7 85872867 missense probably benign 0.03
R7311:Vmn2r73 UTSW 7 85871984 missense possibly damaging 0.80
R7650:Vmn2r73 UTSW 7 85871939 missense probably benign
R7811:Vmn2r73 UTSW 7 85875748 missense possibly damaging 0.77
X0023:Vmn2r73 UTSW 7 85858456 missense probably benign 0.31
Z1176:Vmn2r73 UTSW 7 85871968 missense probably damaging 0.99
Z1177:Vmn2r73 UTSW 7 85872272 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGATGTATTTGGGCGCCC -3'
(R):5'- AATGAAGACCATACTCTCTGTCTCC -3'

Sequencing Primer
(F):5'- ACAAGCAGCCATCTCATTCTTC -3'
(R):5'- AGAGACCCTTTGGGAAAG -3'
Posted On2017-07-14