Incidental Mutation 'R6082:Vmn2r73'
ID 482240
Institutional Source Beutler Lab
Gene Symbol Vmn2r73
Ensembl Gene ENSMUSG00000070458
Gene Name vomeronasal 2, receptor 73
Synonyms EG620928
MMRRC Submission 044241-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.172) question?
Stock # R6082 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 85506755-85525146 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 85507429 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 628 (I628L)
Ref Sequence ENSEMBL: ENSMUSP00000076687 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077478]
AlphaFold D3Z7M3
Predicted Effect probably benign
Transcript: ENSMUST00000077478
AA Change: I628L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000076687
Gene: ENSMUSG00000070458
AA Change: I628L

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 77 465 1.4e-30 PFAM
Pfam:NCD3G 508 560 5.9e-21 PFAM
Pfam:7tm_3 590 827 4.4e-51 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik T C 1: 11,868,752 (GRCm39) I344T probably benign Het
Adamts19 G A 18: 59,101,846 (GRCm39) A639T probably benign Het
Adamts9 T C 6: 92,866,930 (GRCm39) D122G probably damaging Het
Bin2 A G 15: 100,543,029 (GRCm39) S358P possibly damaging Het
Bora A T 14: 99,299,730 (GRCm39) Q234L possibly damaging Het
Btaf1 C T 19: 36,960,942 (GRCm39) R772C probably damaging Het
Cenpf T C 1: 189,390,301 (GRCm39) E1177G probably benign Het
Clec4b2 A T 6: 123,181,100 (GRCm39) probably null Het
Dedd2 G A 7: 24,910,715 (GRCm39) P154S probably benign Het
Dennd5b A G 6: 148,970,193 (GRCm39) S87P probably damaging Het
Dhx8 C T 11: 101,655,139 (GRCm39) R1050W probably damaging Het
Eif3a T C 19: 60,760,568 (GRCm39) K682R possibly damaging Het
Eif4e2 G T 1: 87,153,956 (GRCm39) probably null Het
Ephb1 T C 9: 101,848,303 (GRCm39) D665G probably damaging Het
Gbp7 G A 3: 142,251,697 (GRCm39) V515M probably benign Het
Hnrnpdl C T 5: 100,184,340 (GRCm39) G398S probably null Het
Hook3 C A 8: 26,600,813 (GRCm39) A32S probably benign Het
Hoxb4 T C 11: 96,209,359 (GRCm39) probably benign Het
Idi1 T A 13: 8,940,506 (GRCm39) Y229* probably null Het
Lpl A T 8: 69,349,301 (GRCm39) I276F probably damaging Het
Ltbp4 T C 7: 27,035,105 (GRCm39) probably benign Het
Mphosph8 A G 14: 56,905,998 (GRCm39) I64V probably damaging Het
Mroh1 A G 15: 76,314,423 (GRCm39) D700G probably benign Het
Myt1l G A 12: 29,882,331 (GRCm39) G509R unknown Het
Myt1l T C 12: 29,892,518 (GRCm39) Y52H probably damaging Het
Nlrp9a T A 7: 26,267,402 (GRCm39) D777E probably benign Het
Nudt4 A G 10: 95,387,318 (GRCm39) I82T probably benign Het
Nwd2 T C 5: 63,962,374 (GRCm39) C653R possibly damaging Het
Obscn A G 11: 58,890,393 (GRCm39) Y7380H unknown Het
Or13a18 A G 7: 140,190,594 (GRCm39) T172A probably benign Het
Or8b3b C A 9: 38,583,866 (GRCm39) R291S probably damaging Het
Or8j3 A C 2: 86,028,661 (GRCm39) V145G probably damaging Het
Or8s8 C T 15: 98,354,647 (GRCm39) A152V probably damaging Het
Ptk2 A T 15: 73,148,714 (GRCm39) M409K probably damaging Het
Ptpn11 T C 5: 121,292,589 (GRCm39) T253A probably benign Het
Rabl6 C T 2: 25,473,837 (GRCm39) probably benign Het
Rnf14 T C 18: 38,434,723 (GRCm39) S57P possibly damaging Het
Scnm1 T C 3: 95,037,596 (GRCm39) I157V probably benign Het
Slco1b2 A C 6: 141,609,396 (GRCm39) I269L probably benign Het
Smchd1 A G 17: 71,656,714 (GRCm39) Y1918H probably benign Het
Spag17 A T 3: 100,031,501 (GRCm39) I2255F possibly damaging Het
Spata31g1 A G 4: 42,972,511 (GRCm39) M615V probably benign Het
Tnnt2 A G 1: 135,777,172 (GRCm39) M199V probably benign Het
Tymp GC GCC 15: 89,258,567 (GRCm39) probably null Het
Zc2hc1b C A 10: 13,047,055 (GRCm39) E19* probably null Het
Other mutations in Vmn2r73
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Vmn2r73 APN 7 85,506,795 (GRCm39) missense
IGL01151:Vmn2r73 APN 7 85,507,086 (GRCm39) missense probably damaging 0.99
IGL01408:Vmn2r73 APN 7 85,521,455 (GRCm39) missense probably benign 0.45
IGL01505:Vmn2r73 APN 7 85,507,267 (GRCm39) nonsense probably null
IGL01731:Vmn2r73 APN 7 85,506,757 (GRCm39) makesense probably null
IGL01818:Vmn2r73 APN 7 85,519,109 (GRCm39) splice site probably benign
IGL02236:Vmn2r73 APN 7 85,521,902 (GRCm39) missense probably benign 0.00
IGL02265:Vmn2r73 APN 7 85,520,847 (GRCm39) missense probably benign 0.02
IGL02266:Vmn2r73 APN 7 85,525,007 (GRCm39) missense possibly damaging 0.52
IGL02276:Vmn2r73 APN 7 85,518,980 (GRCm39) critical splice donor site probably null
IGL02284:Vmn2r73 APN 7 85,507,123 (GRCm39) missense possibly damaging 0.92
IGL02380:Vmn2r73 APN 7 85,507,383 (GRCm39) missense probably benign 0.00
IGL02466:Vmn2r73 APN 7 85,522,084 (GRCm39) missense probably damaging 1.00
IGL03172:Vmn2r73 APN 7 85,507,495 (GRCm39) missense probably benign 0.01
IGL03179:Vmn2r73 APN 7 85,519,468 (GRCm39) missense probably benign 0.04
G1Funyon:Vmn2r73 UTSW 7 85,507,510 (GRCm39) missense probably benign 0.00
R0077:Vmn2r73 UTSW 7 85,525,075 (GRCm39) missense probably benign 0.00
R0311:Vmn2r73 UTSW 7 85,520,997 (GRCm39) missense probably benign
R0413:Vmn2r73 UTSW 7 85,521,087 (GRCm39) missense possibly damaging 0.68
R0494:Vmn2r73 UTSW 7 85,522,140 (GRCm39) missense probably benign
R1523:Vmn2r73 UTSW 7 85,519,486 (GRCm39) missense probably benign 0.02
R1618:Vmn2r73 UTSW 7 85,525,120 (GRCm39) nonsense probably null
R1667:Vmn2r73 UTSW 7 85,506,889 (GRCm39) missense probably benign 0.00
R1728:Vmn2r73 UTSW 7 85,507,086 (GRCm39) missense probably damaging 1.00
R1729:Vmn2r73 UTSW 7 85,507,086 (GRCm39) missense probably damaging 1.00
R1747:Vmn2r73 UTSW 7 85,507,375 (GRCm39) missense probably damaging 1.00
R1784:Vmn2r73 UTSW 7 85,507,086 (GRCm39) missense probably damaging 1.00
R2152:Vmn2r73 UTSW 7 85,506,936 (GRCm39) missense probably benign 0.03
R2395:Vmn2r73 UTSW 7 85,506,975 (GRCm39) missense probably damaging 1.00
R2415:Vmn2r73 UTSW 7 85,521,431 (GRCm39) missense probably damaging 1.00
R2926:Vmn2r73 UTSW 7 85,520,871 (GRCm39) missense probably benign 0.17
R3719:Vmn2r73 UTSW 7 85,519,582 (GRCm39) missense probably damaging 1.00
R3766:Vmn2r73 UTSW 7 85,521,198 (GRCm39) missense probably benign
R3838:Vmn2r73 UTSW 7 85,507,258 (GRCm39) missense probably benign 0.00
R3890:Vmn2r73 UTSW 7 85,507,144 (GRCm39) missense probably benign
R4030:Vmn2r73 UTSW 7 85,521,044 (GRCm39) missense possibly damaging 0.92
R4247:Vmn2r73 UTSW 7 85,521,883 (GRCm39) missense probably damaging 0.99
R4409:Vmn2r73 UTSW 7 85,520,768 (GRCm39) missense probably damaging 0.97
R4427:Vmn2r73 UTSW 7 85,506,981 (GRCm39) missense probably damaging 1.00
R4430:Vmn2r73 UTSW 7 85,519,449 (GRCm39) missense probably benign
R4552:Vmn2r73 UTSW 7 85,525,055 (GRCm39) missense probably benign 0.12
R4779:Vmn2r73 UTSW 7 85,520,923 (GRCm39) nonsense probably null
R4906:Vmn2r73 UTSW 7 85,506,829 (GRCm39) missense probably damaging 0.99
R4942:Vmn2r73 UTSW 7 85,519,582 (GRCm39) missense probably damaging 1.00
R5280:Vmn2r73 UTSW 7 85,507,155 (GRCm39) missense probably damaging 0.98
R5344:Vmn2r73 UTSW 7 85,525,046 (GRCm39) missense probably benign 0.00
R5478:Vmn2r73 UTSW 7 85,518,996 (GRCm39) missense probably damaging 1.00
R5527:Vmn2r73 UTSW 7 85,507,575 (GRCm39) missense possibly damaging 0.65
R5691:Vmn2r73 UTSW 7 85,507,299 (GRCm39) missense probably damaging 1.00
R5826:Vmn2r73 UTSW 7 85,524,956 (GRCm39) missense possibly damaging 0.77
R6018:Vmn2r73 UTSW 7 85,521,875 (GRCm39) missense possibly damaging 0.48
R6111:Vmn2r73 UTSW 7 85,520,997 (GRCm39) missense probably benign
R6233:Vmn2r73 UTSW 7 85,519,099 (GRCm39) missense probably benign 0.00
R6278:Vmn2r73 UTSW 7 85,522,140 (GRCm39) missense probably benign
R6283:Vmn2r73 UTSW 7 85,521,049 (GRCm39) missense probably benign 0.00
R6307:Vmn2r73 UTSW 7 85,506,828 (GRCm39) missense probably damaging 1.00
R6413:Vmn2r73 UTSW 7 85,519,544 (GRCm39) nonsense probably null
R6782:Vmn2r73 UTSW 7 85,519,563 (GRCm39) missense probably benign 0.00
R6884:Vmn2r73 UTSW 7 85,507,213 (GRCm39) missense probably benign 0.05
R6921:Vmn2r73 UTSW 7 85,507,446 (GRCm39) missense probably benign 0.27
R7169:Vmn2r73 UTSW 7 85,507,663 (GRCm39) nonsense probably null
R7206:Vmn2r73 UTSW 7 85,522,075 (GRCm39) missense probably benign 0.03
R7311:Vmn2r73 UTSW 7 85,521,192 (GRCm39) missense possibly damaging 0.80
R7650:Vmn2r73 UTSW 7 85,521,147 (GRCm39) missense probably benign
R7811:Vmn2r73 UTSW 7 85,524,956 (GRCm39) missense possibly damaging 0.77
R8263:Vmn2r73 UTSW 7 85,507,619 (GRCm39) missense probably benign
R8301:Vmn2r73 UTSW 7 85,507,510 (GRCm39) missense probably benign 0.00
R8341:Vmn2r73 UTSW 7 85,507,128 (GRCm39) missense probably benign 0.01
R8500:Vmn2r73 UTSW 7 85,519,638 (GRCm39) missense probably benign 0.01
R8673:Vmn2r73 UTSW 7 85,521,902 (GRCm39) missense probably benign 0.01
R8719:Vmn2r73 UTSW 7 85,521,095 (GRCm39) missense probably damaging 0.96
R8783:Vmn2r73 UTSW 7 85,507,668 (GRCm39) missense probably damaging 0.96
R8828:Vmn2r73 UTSW 7 85,521,179 (GRCm39) missense probably damaging 0.98
R8860:Vmn2r73 UTSW 7 85,522,149 (GRCm39) splice site probably benign
R9002:Vmn2r73 UTSW 7 85,507,284 (GRCm39) missense probably benign 0.32
R9008:Vmn2r73 UTSW 7 85,521,904 (GRCm39) missense probably damaging 0.96
R9159:Vmn2r73 UTSW 7 85,521,931 (GRCm39) missense possibly damaging 0.90
R9180:Vmn2r73 UTSW 7 85,507,123 (GRCm39) missense probably benign 0.07
R9198:Vmn2r73 UTSW 7 85,518,987 (GRCm39) missense probably benign 0.01
R9329:Vmn2r73 UTSW 7 85,519,073 (GRCm39) missense probably benign
R9448:Vmn2r73 UTSW 7 85,522,027 (GRCm39) missense probably benign 0.00
R9463:Vmn2r73 UTSW 7 85,506,795 (GRCm39) missense
R9589:Vmn2r73 UTSW 7 85,519,659 (GRCm39) missense probably benign 0.03
X0023:Vmn2r73 UTSW 7 85,507,664 (GRCm39) missense probably benign 0.31
Z1176:Vmn2r73 UTSW 7 85,521,176 (GRCm39) missense probably damaging 0.99
Z1177:Vmn2r73 UTSW 7 85,521,480 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGATGTATTTGGGCGCCC -3'
(R):5'- AATGAAGACCATACTCTCTGTCTCC -3'

Sequencing Primer
(F):5'- ACAAGCAGCCATCTCATTCTTC -3'
(R):5'- AGAGACCCTTTGGGAAAG -3'
Posted On 2017-07-14