Incidental Mutation 'R6082:Or13a18'
ID 482241
Institutional Source Beutler Lab
Gene Symbol Or13a18
Ensembl Gene ENSMUSG00000093942
Gene Name olfactory receptor family 13 subfamily A member 18
Synonyms IB7, IF5, ID12, GA_x6K02T2PBJ9-42759973-42760905, Olfr46, MOR253-8
MMRRC Submission 044241-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.097) question?
Stock # R6082 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 140181253-140191037 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 140190594 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 172 (T172A)
Ref Sequence ENSEMBL: ENSMUSP00000072445 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072655] [ENSMUST00000211771] [ENSMUST00000214180]
AlphaFold Q8VGJ4
Predicted Effect probably benign
Transcript: ENSMUST00000072655
AA Change: T172A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000072445
Gene: ENSMUSG00000093942
AA Change: T172A

DomainStartEndE-ValueType
Pfam:7tm_4 39 315 1.1e-50 PFAM
Pfam:7TM_GPCR_Srsx 43 209 5.9e-8 PFAM
Pfam:7tm_1 49 298 3.4e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000211771
AA Change: T164A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000214180
AA Change: T164A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik T C 1: 11,868,752 (GRCm39) I344T probably benign Het
Adamts19 G A 18: 59,101,846 (GRCm39) A639T probably benign Het
Adamts9 T C 6: 92,866,930 (GRCm39) D122G probably damaging Het
Bin2 A G 15: 100,543,029 (GRCm39) S358P possibly damaging Het
Bora A T 14: 99,299,730 (GRCm39) Q234L possibly damaging Het
Btaf1 C T 19: 36,960,942 (GRCm39) R772C probably damaging Het
Cenpf T C 1: 189,390,301 (GRCm39) E1177G probably benign Het
Clec4b2 A T 6: 123,181,100 (GRCm39) probably null Het
Dedd2 G A 7: 24,910,715 (GRCm39) P154S probably benign Het
Dennd5b A G 6: 148,970,193 (GRCm39) S87P probably damaging Het
Dhx8 C T 11: 101,655,139 (GRCm39) R1050W probably damaging Het
Eif3a T C 19: 60,760,568 (GRCm39) K682R possibly damaging Het
Eif4e2 G T 1: 87,153,956 (GRCm39) probably null Het
Ephb1 T C 9: 101,848,303 (GRCm39) D665G probably damaging Het
Gbp7 G A 3: 142,251,697 (GRCm39) V515M probably benign Het
Hnrnpdl C T 5: 100,184,340 (GRCm39) G398S probably null Het
Hook3 C A 8: 26,600,813 (GRCm39) A32S probably benign Het
Hoxb4 T C 11: 96,209,359 (GRCm39) probably benign Het
Idi1 T A 13: 8,940,506 (GRCm39) Y229* probably null Het
Lpl A T 8: 69,349,301 (GRCm39) I276F probably damaging Het
Ltbp4 T C 7: 27,035,105 (GRCm39) probably benign Het
Mphosph8 A G 14: 56,905,998 (GRCm39) I64V probably damaging Het
Mroh1 A G 15: 76,314,423 (GRCm39) D700G probably benign Het
Myt1l G A 12: 29,882,331 (GRCm39) G509R unknown Het
Myt1l T C 12: 29,892,518 (GRCm39) Y52H probably damaging Het
Nlrp9a T A 7: 26,267,402 (GRCm39) D777E probably benign Het
Nudt4 A G 10: 95,387,318 (GRCm39) I82T probably benign Het
Nwd2 T C 5: 63,962,374 (GRCm39) C653R possibly damaging Het
Obscn A G 11: 58,890,393 (GRCm39) Y7380H unknown Het
Or8b3b C A 9: 38,583,866 (GRCm39) R291S probably damaging Het
Or8j3 A C 2: 86,028,661 (GRCm39) V145G probably damaging Het
Or8s8 C T 15: 98,354,647 (GRCm39) A152V probably damaging Het
Ptk2 A T 15: 73,148,714 (GRCm39) M409K probably damaging Het
Ptpn11 T C 5: 121,292,589 (GRCm39) T253A probably benign Het
Rabl6 C T 2: 25,473,837 (GRCm39) probably benign Het
Rnf14 T C 18: 38,434,723 (GRCm39) S57P possibly damaging Het
Scnm1 T C 3: 95,037,596 (GRCm39) I157V probably benign Het
Slco1b2 A C 6: 141,609,396 (GRCm39) I269L probably benign Het
Smchd1 A G 17: 71,656,714 (GRCm39) Y1918H probably benign Het
Spag17 A T 3: 100,031,501 (GRCm39) I2255F possibly damaging Het
Spata31g1 A G 4: 42,972,511 (GRCm39) M615V probably benign Het
Tnnt2 A G 1: 135,777,172 (GRCm39) M199V probably benign Het
Tymp GC GCC 15: 89,258,567 (GRCm39) probably null Het
Vmn2r73 T A 7: 85,507,429 (GRCm39) I628L probably benign Het
Zc2hc1b C A 10: 13,047,055 (GRCm39) E19* probably null Het
Other mutations in Or13a18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Or13a18 APN 7 140,190,666 (GRCm39) missense probably damaging 1.00
IGL02408:Or13a18 APN 7 140,190,844 (GRCm39) missense probably damaging 1.00
IGL02496:Or13a18 APN 7 140,190,081 (GRCm39) start codon destroyed probably benign
IGL03003:Or13a18 APN 7 140,190,283 (GRCm39) missense probably damaging 1.00
R0538:Or13a18 UTSW 7 140,190,297 (GRCm39) missense probably damaging 1.00
R1350:Or13a18 UTSW 7 140,190,622 (GRCm39) missense probably damaging 0.96
R1466:Or13a18 UTSW 7 140,190,882 (GRCm39) missense probably benign 0.01
R1466:Or13a18 UTSW 7 140,190,882 (GRCm39) missense probably benign 0.01
R2008:Or13a18 UTSW 7 140,190,498 (GRCm39) missense probably damaging 1.00
R4110:Or13a18 UTSW 7 140,190,178 (GRCm39) missense possibly damaging 0.89
R4110:Or13a18 UTSW 7 140,190,177 (GRCm39) missense probably benign 0.20
R4255:Or13a18 UTSW 7 140,190,500 (GRCm39) nonsense probably null
R4622:Or13a18 UTSW 7 140,190,611 (GRCm39) nonsense probably null
R4809:Or13a18 UTSW 7 140,190,987 (GRCm39) missense probably damaging 0.98
R4826:Or13a18 UTSW 7 140,190,232 (GRCm39) missense probably benign 0.02
R4989:Or13a18 UTSW 7 140,190,304 (GRCm39) missense possibly damaging 0.95
R5177:Or13a18 UTSW 7 140,190,102 (GRCm39) missense probably benign 0.00
R5261:Or13a18 UTSW 7 140,190,576 (GRCm39) missense probably benign 0.00
R5770:Or13a18 UTSW 7 140,190,856 (GRCm39) missense probably damaging 1.00
R5863:Or13a18 UTSW 7 140,190,544 (GRCm39) missense probably damaging 0.97
R6705:Or13a18 UTSW 7 140,190,697 (GRCm39) missense probably damaging 0.99
R7216:Or13a18 UTSW 7 140,190,373 (GRCm39) missense possibly damaging 0.87
R7443:Or13a18 UTSW 7 140,190,961 (GRCm39) missense probably damaging 1.00
R7485:Or13a18 UTSW 7 140,190,091 (GRCm39) missense probably benign 0.02
R7806:Or13a18 UTSW 7 140,190,685 (GRCm39) missense probably benign 0.00
R8373:Or13a18 UTSW 7 140,190,208 (GRCm39) missense possibly damaging 0.88
R8884:Or13a18 UTSW 7 140,190,616 (GRCm39) missense probably damaging 1.00
R9278:Or13a18 UTSW 7 140,190,936 (GRCm39) missense probably damaging 1.00
R9595:Or13a18 UTSW 7 140,190,939 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CACCATCTCCTTCAAAGGGTGC -3'
(R):5'- GCAGGATGCTGGCAATGATG -3'

Sequencing Primer
(F):5'- TCCTTCAAAGGGTGCATGAC -3'
(R):5'- TGATGCAGCCATAGGATAGC -3'
Posted On 2017-07-14