Incidental Mutation 'R6082:Ephb1'
ID 482245
Institutional Source Beutler Lab
Gene Symbol Ephb1
Ensembl Gene ENSMUSG00000032537
Gene Name Eph receptor B1
Synonyms Net, C130099E04Rik, Cek6, Hek6, Elkh, Elk
MMRRC Submission 044241-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6082 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 101799327-102231892 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 101848303 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 665 (D665G)
Ref Sequence ENSEMBL: ENSMUSP00000082261 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035129] [ENSMUST00000085169]
AlphaFold Q8CBF3
Predicted Effect probably damaging
Transcript: ENSMUST00000035129
AA Change: D706G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000035129
Gene: ENSMUSG00000032537
AA Change: D706G

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
EPH_lbd 19 196 1.69e-129 SMART
FN3 323 416 2.44e-5 SMART
FN3 434 515 2.26e-9 SMART
Pfam:EphA2_TM 542 616 3e-24 PFAM
TyrKc 619 878 6.45e-141 SMART
SAM 908 975 1.22e-21 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000085169
AA Change: D665G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000082261
Gene: ENSMUSG00000032537
AA Change: D665G

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
EPH_lbd 19 196 1.69e-129 SMART
FN3 323 416 2.44e-5 SMART
FN3 434 515 2.26e-9 SMART
transmembrane domain 541 563 N/A INTRINSIC
TyrKc 585 837 2.35e-134 SMART
SAM 867 934 1.22e-21 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ephrin receptors and their ligands, the ephrins, mediate numerous developmental processes, particularly in the nervous system. Based on their structures and sequence relationships, ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. The Eph family of receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Ephrin receptors make up the largest subgroup of the receptor tyrosine kinase (RTK) family. The protein encoded by this gene is a receptor for ephrin-B family members. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions of this gene display marked reductions of the ipsilateral optic tract. Homozygotes for one null allele show reduced corticospinal tract and abnormal anterior commissure axon crossing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik T C 1: 11,868,752 (GRCm39) I344T probably benign Het
Adamts19 G A 18: 59,101,846 (GRCm39) A639T probably benign Het
Adamts9 T C 6: 92,866,930 (GRCm39) D122G probably damaging Het
Bin2 A G 15: 100,543,029 (GRCm39) S358P possibly damaging Het
Bora A T 14: 99,299,730 (GRCm39) Q234L possibly damaging Het
Btaf1 C T 19: 36,960,942 (GRCm39) R772C probably damaging Het
Cenpf T C 1: 189,390,301 (GRCm39) E1177G probably benign Het
Clec4b2 A T 6: 123,181,100 (GRCm39) probably null Het
Dedd2 G A 7: 24,910,715 (GRCm39) P154S probably benign Het
Dennd5b A G 6: 148,970,193 (GRCm39) S87P probably damaging Het
Dhx8 C T 11: 101,655,139 (GRCm39) R1050W probably damaging Het
Eif3a T C 19: 60,760,568 (GRCm39) K682R possibly damaging Het
Eif4e2 G T 1: 87,153,956 (GRCm39) probably null Het
Gbp7 G A 3: 142,251,697 (GRCm39) V515M probably benign Het
Hnrnpdl C T 5: 100,184,340 (GRCm39) G398S probably null Het
Hook3 C A 8: 26,600,813 (GRCm39) A32S probably benign Het
Hoxb4 T C 11: 96,209,359 (GRCm39) probably benign Het
Idi1 T A 13: 8,940,506 (GRCm39) Y229* probably null Het
Lpl A T 8: 69,349,301 (GRCm39) I276F probably damaging Het
Ltbp4 T C 7: 27,035,105 (GRCm39) probably benign Het
Mphosph8 A G 14: 56,905,998 (GRCm39) I64V probably damaging Het
Mroh1 A G 15: 76,314,423 (GRCm39) D700G probably benign Het
Myt1l G A 12: 29,882,331 (GRCm39) G509R unknown Het
Myt1l T C 12: 29,892,518 (GRCm39) Y52H probably damaging Het
Nlrp9a T A 7: 26,267,402 (GRCm39) D777E probably benign Het
Nudt4 A G 10: 95,387,318 (GRCm39) I82T probably benign Het
Nwd2 T C 5: 63,962,374 (GRCm39) C653R possibly damaging Het
Obscn A G 11: 58,890,393 (GRCm39) Y7380H unknown Het
Or13a18 A G 7: 140,190,594 (GRCm39) T172A probably benign Het
Or8b3b C A 9: 38,583,866 (GRCm39) R291S probably damaging Het
Or8j3 A C 2: 86,028,661 (GRCm39) V145G probably damaging Het
Or8s8 C T 15: 98,354,647 (GRCm39) A152V probably damaging Het
Ptk2 A T 15: 73,148,714 (GRCm39) M409K probably damaging Het
Ptpn11 T C 5: 121,292,589 (GRCm39) T253A probably benign Het
Rabl6 C T 2: 25,473,837 (GRCm39) probably benign Het
Rnf14 T C 18: 38,434,723 (GRCm39) S57P possibly damaging Het
Scnm1 T C 3: 95,037,596 (GRCm39) I157V probably benign Het
Slco1b2 A C 6: 141,609,396 (GRCm39) I269L probably benign Het
Smchd1 A G 17: 71,656,714 (GRCm39) Y1918H probably benign Het
Spag17 A T 3: 100,031,501 (GRCm39) I2255F possibly damaging Het
Spata31g1 A G 4: 42,972,511 (GRCm39) M615V probably benign Het
Tnnt2 A G 1: 135,777,172 (GRCm39) M199V probably benign Het
Tymp GC GCC 15: 89,258,567 (GRCm39) probably null Het
Vmn2r73 T A 7: 85,507,429 (GRCm39) I628L probably benign Het
Zc2hc1b C A 10: 13,047,055 (GRCm39) E19* probably null Het
Other mutations in Ephb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01671:Ephb1 APN 9 101,873,986 (GRCm39) missense probably damaging 1.00
IGL01910:Ephb1 APN 9 101,879,056 (GRCm39) missense probably benign 0.00
IGL02006:Ephb1 APN 9 102,071,971 (GRCm39) critical splice donor site probably null
IGL02660:Ephb1 APN 9 101,918,291 (GRCm39) missense possibly damaging 0.94
IGL02685:Ephb1 APN 9 101,918,302 (GRCm39) nonsense probably null
IGL02802:Ephb1 UTSW 9 101,887,218 (GRCm39) missense possibly damaging 0.87
R0098:Ephb1 UTSW 9 101,918,339 (GRCm39) missense probably damaging 0.98
R0098:Ephb1 UTSW 9 101,918,339 (GRCm39) missense probably damaging 0.98
R0180:Ephb1 UTSW 9 101,804,703 (GRCm39) missense probably damaging 0.99
R0488:Ephb1 UTSW 9 101,841,207 (GRCm39) missense probably damaging 1.00
R0511:Ephb1 UTSW 9 101,873,179 (GRCm39) splice site probably benign
R0601:Ephb1 UTSW 9 102,072,329 (GRCm39) missense probably damaging 1.00
R1622:Ephb1 UTSW 9 101,878,910 (GRCm39) missense probably benign 0.00
R1643:Ephb1 UTSW 9 101,874,024 (GRCm39) missense probably damaging 0.99
R1645:Ephb1 UTSW 9 101,804,758 (GRCm39) missense probably damaging 1.00
R1914:Ephb1 UTSW 9 101,806,577 (GRCm39) missense probably damaging 1.00
R1964:Ephb1 UTSW 9 101,848,322 (GRCm39) missense possibly damaging 0.93
R2245:Ephb1 UTSW 9 101,873,973 (GRCm39) splice site probably benign
R2247:Ephb1 UTSW 9 101,874,010 (GRCm39) missense probably damaging 0.98
R2412:Ephb1 UTSW 9 101,879,015 (GRCm39) missense possibly damaging 0.85
R3716:Ephb1 UTSW 9 102,071,999 (GRCm39) missense probably damaging 1.00
R3756:Ephb1 UTSW 9 101,918,238 (GRCm39) missense probably benign 0.01
R3797:Ephb1 UTSW 9 101,848,466 (GRCm39) missense probably damaging 1.00
R3907:Ephb1 UTSW 9 101,878,925 (GRCm39) missense probably benign 0.00
R4981:Ephb1 UTSW 9 101,918,159 (GRCm39) missense probably benign
R5112:Ephb1 UTSW 9 101,848,378 (GRCm39) missense probably damaging 1.00
R5507:Ephb1 UTSW 9 101,813,315 (GRCm39) missense probably damaging 1.00
R5745:Ephb1 UTSW 9 102,072,633 (GRCm39) missense probably benign 0.25
R6183:Ephb1 UTSW 9 102,072,524 (GRCm39) missense probably damaging 1.00
R6228:Ephb1 UTSW 9 101,800,783 (GRCm39) missense probably damaging 1.00
R6572:Ephb1 UTSW 9 101,944,097 (GRCm39) missense probably benign
R6596:Ephb1 UTSW 9 102,072,001 (GRCm39) nonsense probably null
R6813:Ephb1 UTSW 9 101,887,247 (GRCm39) missense possibly damaging 0.87
R6876:Ephb1 UTSW 9 101,861,319 (GRCm39) missense probably damaging 1.00
R6922:Ephb1 UTSW 9 101,806,463 (GRCm39) splice site probably null
R6950:Ephb1 UTSW 9 102,072,108 (GRCm39) missense probably benign 0.03
R7144:Ephb1 UTSW 9 101,841,276 (GRCm39) missense probably damaging 1.00
R7146:Ephb1 UTSW 9 101,841,157 (GRCm39) missense probably damaging 1.00
R7328:Ephb1 UTSW 9 102,072,438 (GRCm39) missense probably damaging 1.00
R7644:Ephb1 UTSW 9 101,813,393 (GRCm39) missense probably damaging 1.00
R7737:Ephb1 UTSW 9 101,861,302 (GRCm39) missense probably damaging 1.00
R8109:Ephb1 UTSW 9 101,918,222 (GRCm39) missense probably damaging 1.00
R8161:Ephb1 UTSW 9 102,072,012 (GRCm39) missense probably damaging 1.00
R8486:Ephb1 UTSW 9 101,841,164 (GRCm39) missense probably benign 0.00
R8958:Ephb1 UTSW 9 102,072,614 (GRCm39) missense probably damaging 1.00
R9502:Ephb1 UTSW 9 101,918,486 (GRCm39) missense probably damaging 1.00
R9627:Ephb1 UTSW 9 101,918,468 (GRCm39) missense possibly damaging 0.94
R9715:Ephb1 UTSW 9 101,848,384 (GRCm39) missense probably damaging 1.00
X0064:Ephb1 UTSW 9 101,848,471 (GRCm39) missense probably damaging 1.00
Z1088:Ephb1 UTSW 9 101,861,344 (GRCm39) missense probably damaging 0.99
Z1176:Ephb1 UTSW 9 102,100,597 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATCAGGCAATGCTTTGTTCC -3'
(R):5'- ATCAAGACCCTGAAGGCTGG -3'

Sequencing Primer
(F):5'- GAAGCATCCTGATTGGTTACCCAG -3'
(R):5'- CTGGGTACTCAGAGAAACAGCGTC -3'
Posted On 2017-07-14