Incidental Mutation 'R6082:Dhx8'
ID482250
Institutional Source Beutler Lab
Gene Symbol Dhx8
Ensembl Gene ENSMUSG00000034931
Gene NameDEAH (Asp-Glu-Ala-His) box polypeptide 8
SynonymsRNA helicase, Ddx8, mDEAH6
MMRRC Submission 044241-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock #R6082 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location101732919-101767358 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 101764313 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 1050 (R1050W)
Ref Sequence ENSEMBL: ENSMUSP00000119430 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039152] [ENSMUST00000129741]
Predicted Effect probably damaging
Transcript: ENSMUST00000039152
AA Change: R1103W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037251
Gene: ENSMUSG00000034931
AA Change: R1103W

DomainStartEndE-ValueType
low complexity region 2 8 N/A INTRINSIC
low complexity region 168 240 N/A INTRINSIC
low complexity region 244 254 N/A INTRINSIC
S1 287 360 3.52e-18 SMART
low complexity region 453 469 N/A INTRINSIC
coiled coil region 496 525 N/A INTRINSIC
DEXDc 587 771 7.26e-33 SMART
HELICc 815 919 7.45e-21 SMART
HA2 980 1070 1.34e-38 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000129741
AA Change: R1050W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119430
Gene: ENSMUSG00000034931
AA Change: R1050W

DomainStartEndE-ValueType
low complexity region 2 8 N/A INTRINSIC
low complexity region 115 187 N/A INTRINSIC
low complexity region 191 201 N/A INTRINSIC
S1 234 307 3.52e-18 SMART
low complexity region 400 416 N/A INTRINSIC
coiled coil region 443 472 N/A INTRINSIC
DEXDc 534 718 7.26e-33 SMART
HELICc 762 866 7.45e-21 SMART
HA2 927 1017 1.34e-38 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the DEAH box polypeptide family. The encoded protein contains the DEAH (Asp-Glu-Ala-His) motif which is characteristic of all DEAH box proteins, and is thought to function as an ATP-dependent RNA helicase that regulates the release of spliced mRNAs from spliceosomes prior to their export from the nucleus. This protein may be required for the replication of human immunodeficiency virus type 1 (HIV-1). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A G 4: 42,972,511 M615V probably benign Het
A830018L16Rik T C 1: 11,798,528 I344T probably benign Het
Adamts19 G A 18: 58,968,774 A639T probably benign Het
Adamts9 T C 6: 92,889,949 D122G probably damaging Het
Bin2 A G 15: 100,645,148 S358P possibly damaging Het
Bora A T 14: 99,062,294 Q234L possibly damaging Het
Btaf1 C T 19: 36,983,542 R772C probably damaging Het
Cenpf T C 1: 189,658,104 E1177G probably benign Het
Clec4b2 A T 6: 123,204,141 probably null Het
Dedd2 G A 7: 25,211,290 P154S probably benign Het
Dennd5b A G 6: 149,068,695 S87P probably damaging Het
Eif3a T C 19: 60,772,130 K682R possibly damaging Het
Eif4e2 G T 1: 87,226,234 probably null Het
Ephb1 T C 9: 101,971,104 D665G probably damaging Het
Gbp7 G A 3: 142,545,936 V515M probably benign Het
Hnrnpdl C T 5: 100,036,481 G398S probably null Het
Hook3 C A 8: 26,110,785 A32S probably benign Het
Hoxb4 T C 11: 96,318,533 probably benign Het
Idi1 T A 13: 8,890,470 Y229* probably null Het
Lpl A T 8: 68,896,649 I276F probably damaging Het
Ltbp4 T C 7: 27,335,680 probably benign Het
Mphosph8 A G 14: 56,668,541 I64V probably damaging Het
Mroh1 A G 15: 76,430,223 D700G probably benign Het
Myt1l G A 12: 29,832,332 G509R unknown Het
Myt1l T C 12: 29,842,519 Y52H probably damaging Het
Nlrp9a T A 7: 26,567,977 D777E probably benign Het
Nudt4 A G 10: 95,551,456 I82T probably benign Het
Nwd2 T C 5: 63,805,031 C653R possibly damaging Het
Obscn A G 11: 58,999,567 Y7380H unknown Het
Olfr1045 A C 2: 86,198,317 V145G probably damaging Het
Olfr281 C T 15: 98,456,766 A152V probably damaging Het
Olfr46 A G 7: 140,610,681 T172A probably benign Het
Olfr918 C A 9: 38,672,570 R291S probably damaging Het
Ptk2 A T 15: 73,276,865 M409K probably damaging Het
Ptpn11 T C 5: 121,154,526 T253A probably benign Het
Rabl6 C T 2: 25,583,825 probably benign Het
Rnf14 T C 18: 38,301,670 S57P possibly damaging Het
Scnm1 T C 3: 95,130,285 I157V probably benign Het
Slco1b2 A C 6: 141,663,670 I269L probably benign Het
Smchd1 A G 17: 71,349,719 Y1918H probably benign Het
Spag17 A T 3: 100,124,185 I2255F possibly damaging Het
Tnnt2 A G 1: 135,849,434 M199V probably benign Het
Tymp GC GCC 15: 89,374,364 probably null Het
Vmn2r73 T A 7: 85,858,221 I628L probably benign Het
Zc2hc1b C A 10: 13,171,311 E19* probably null Het
Other mutations in Dhx8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01922:Dhx8 APN 11 101739807 missense probably damaging 0.99
IGL01957:Dhx8 APN 11 101754826 missense possibly damaging 0.48
IGL02039:Dhx8 APN 11 101764027 critical splice donor site probably null
IGL02115:Dhx8 APN 11 101752388 missense probably damaging 1.00
IGL02161:Dhx8 APN 11 101757606 missense probably damaging 1.00
IGL02691:Dhx8 APN 11 101752004 splice site probably benign
IGL02697:Dhx8 APN 11 101754781 missense probably damaging 1.00
FR4304:Dhx8 UTSW 11 101738188 small insertion probably benign
FR4342:Dhx8 UTSW 11 101738206 frame shift probably null
FR4449:Dhx8 UTSW 11 101738184 small insertion probably benign
FR4449:Dhx8 UTSW 11 101738190 small deletion probably benign
FR4449:Dhx8 UTSW 11 101738194 small insertion probably benign
FR4449:Dhx8 UTSW 11 101738206 small insertion probably benign
FR4449:Dhx8 UTSW 11 101738207 small insertion probably benign
FR4589:Dhx8 UTSW 11 101738188 small insertion probably benign
FR4737:Dhx8 UTSW 11 101738179 small insertion probably benign
FR4737:Dhx8 UTSW 11 101738182 small insertion probably benign
FR4737:Dhx8 UTSW 11 101738189 small insertion probably benign
R0402:Dhx8 UTSW 11 101752397 missense probably damaging 1.00
R0525:Dhx8 UTSW 11 101763928 missense probably damaging 1.00
R0969:Dhx8 UTSW 11 101739700 splice site probably benign
R1497:Dhx8 UTSW 11 101735387 intron probably benign
R1576:Dhx8 UTSW 11 101752319 missense probably damaging 1.00
R1758:Dhx8 UTSW 11 101766738 missense probably damaging 1.00
R1773:Dhx8 UTSW 11 101752363 missense possibly damaging 0.87
R1941:Dhx8 UTSW 11 101752198 critical splice donor site probably null
R1954:Dhx8 UTSW 11 101753279 missense probably damaging 0.98
R2124:Dhx8 UTSW 11 101762245 missense probably damaging 0.99
R2128:Dhx8 UTSW 11 101738409 missense probably benign 0.06
R2148:Dhx8 UTSW 11 101738377 nonsense probably null
R2206:Dhx8 UTSW 11 101750971 missense probably benign 0.03
R2207:Dhx8 UTSW 11 101750971 missense probably benign 0.03
R4667:Dhx8 UTSW 11 101738161 missense unknown
R4678:Dhx8 UTSW 11 101739808 missense probably damaging 1.00
R4825:Dhx8 UTSW 11 101738170 nonsense probably null
R4943:Dhx8 UTSW 11 101737700 nonsense probably null
R5341:Dhx8 UTSW 11 101738190 small deletion probably benign
R5586:Dhx8 UTSW 11 101733036 unclassified probably benign
R5662:Dhx8 UTSW 11 101766758 missense possibly damaging 0.89
R5664:Dhx8 UTSW 11 101740751 missense probably damaging 1.00
R6085:Dhx8 UTSW 11 101764313 missense probably damaging 1.00
R6415:Dhx8 UTSW 11 101737687 missense unknown
R6658:Dhx8 UTSW 11 101764922 missense probably damaging 1.00
R6841:Dhx8 UTSW 11 101764792 missense probably damaging 0.98
R6918:Dhx8 UTSW 11 101738421 nonsense probably null
R7011:Dhx8 UTSW 11 101741520 missense probably damaging 1.00
R7098:Dhx8 UTSW 11 101737768 critical splice donor site probably null
R7153:Dhx8 UTSW 11 101740175 intron probably null
R7284:Dhx8 UTSW 11 101754822 missense probably damaging 1.00
R7604:Dhx8 UTSW 11 101764797 missense probably damaging 1.00
Z1177:Dhx8 UTSW 11 101757660 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAATGACTCTCTGTCCCACTGC -3'
(R):5'- GTTTCTGAAGTGCTGCTTAGCC -3'

Sequencing Primer
(F):5'- CCTGGCAGGATAAACAGGCC -3'
(R):5'- GAAGTGCTGCTTAGCCACACTC -3'
Posted On2017-07-14