Incidental Mutation 'R6082:Bora'
ID482255
Institutional Source Beutler Lab
Gene Symbol Bora
Ensembl Gene ENSMUSG00000022070
Gene Namebora, aurora kinase A activator
Synonyms6720463M24Rik
MMRRC Submission 044241-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.919) question?
Stock #R6082 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location99046222-99074540 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 99062294 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 234 (Q234L)
Ref Sequence ENSEMBL: ENSMUSP00000154660 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022656] [ENSMUST00000227128] [ENSMUST00000227744]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022656
AA Change: Q234L

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000022656
Gene: ENSMUSG00000022070
AA Change: Q234L

DomainStartEndE-ValueType
Pfam:BORA_N 7 207 2.4e-69 PFAM
low complexity region 392 403 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000227128
Predicted Effect possibly damaging
Transcript: ENSMUST00000227744
AA Change: Q234L

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
Meta Mutation Damage Score 0.0769 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] BORA is an activator of the protein kinase Aurora A (AURKA; MIM 603072), which is required for centrosome maturation, spindle assembly, and asymmetric protein localization during mitosis (Hutterer et al., 2006 [PubMed 16890155]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A G 4: 42,972,511 M615V probably benign Het
A830018L16Rik T C 1: 11,798,528 I344T probably benign Het
Adamts19 G A 18: 58,968,774 A639T probably benign Het
Adamts9 T C 6: 92,889,949 D122G probably damaging Het
Bin2 A G 15: 100,645,148 S358P possibly damaging Het
Btaf1 C T 19: 36,983,542 R772C probably damaging Het
Cenpf T C 1: 189,658,104 E1177G probably benign Het
Clec4b2 A T 6: 123,204,141 probably null Het
Dedd2 G A 7: 25,211,290 P154S probably benign Het
Dennd5b A G 6: 149,068,695 S87P probably damaging Het
Dhx8 C T 11: 101,764,313 R1050W probably damaging Het
Eif3a T C 19: 60,772,130 K682R possibly damaging Het
Eif4e2 G T 1: 87,226,234 probably null Het
Ephb1 T C 9: 101,971,104 D665G probably damaging Het
Gbp7 G A 3: 142,545,936 V515M probably benign Het
Hnrnpdl C T 5: 100,036,481 G398S probably null Het
Hook3 C A 8: 26,110,785 A32S probably benign Het
Hoxb4 T C 11: 96,318,533 probably benign Het
Idi1 T A 13: 8,890,470 Y229* probably null Het
Lpl A T 8: 68,896,649 I276F probably damaging Het
Ltbp4 T C 7: 27,335,680 probably benign Het
Mphosph8 A G 14: 56,668,541 I64V probably damaging Het
Mroh1 A G 15: 76,430,223 D700G probably benign Het
Myt1l G A 12: 29,832,332 G509R unknown Het
Myt1l T C 12: 29,842,519 Y52H probably damaging Het
Nlrp9a T A 7: 26,567,977 D777E probably benign Het
Nudt4 A G 10: 95,551,456 I82T probably benign Het
Nwd2 T C 5: 63,805,031 C653R possibly damaging Het
Obscn A G 11: 58,999,567 Y7380H unknown Het
Olfr1045 A C 2: 86,198,317 V145G probably damaging Het
Olfr281 C T 15: 98,456,766 A152V probably damaging Het
Olfr46 A G 7: 140,610,681 T172A probably benign Het
Olfr918 C A 9: 38,672,570 R291S probably damaging Het
Ptk2 A T 15: 73,276,865 M409K probably damaging Het
Ptpn11 T C 5: 121,154,526 T253A probably benign Het
Rabl6 C T 2: 25,583,825 probably benign Het
Rnf14 T C 18: 38,301,670 S57P possibly damaging Het
Scnm1 T C 3: 95,130,285 I157V probably benign Het
Slco1b2 A C 6: 141,663,670 I269L probably benign Het
Smchd1 A G 17: 71,349,719 Y1918H probably benign Het
Spag17 A T 3: 100,124,185 I2255F possibly damaging Het
Tnnt2 A G 1: 135,849,434 M199V probably benign Het
Tymp GC GCC 15: 89,374,364 probably null Het
Vmn2r73 T A 7: 85,858,221 I628L probably benign Het
Zc2hc1b C A 10: 13,171,311 E19* probably null Het
Other mutations in Bora
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02111:Bora APN 14 99047377 missense probably damaging 1.00
IGL02119:Bora APN 14 99053538 missense probably damaging 1.00
IGL02129:Bora APN 14 99056821 critical splice donor site probably null
IGL02171:Bora APN 14 99047322 missense probably damaging 1.00
IGL03338:Bora APN 14 99072742 missense probably damaging 1.00
R0504:Bora UTSW 14 99061623 nonsense probably null
R1598:Bora UTSW 14 99068404 missense probably benign
R2070:Bora UTSW 14 99062278 missense probably damaging 1.00
R2071:Bora UTSW 14 99062278 missense probably damaging 1.00
R4521:Bora UTSW 14 99068548 missense probably damaging 0.99
R4861:Bora UTSW 14 99047474 splice site probably null
R4881:Bora UTSW 14 99061567 missense probably damaging 1.00
R4982:Bora UTSW 14 99047352 missense probably damaging 1.00
R5341:Bora UTSW 14 99068094 missense probably damaging 1.00
R5378:Bora UTSW 14 99068493 missense probably damaging 1.00
R5913:Bora UTSW 14 99068512 missense probably benign 0.02
R6083:Bora UTSW 14 99062294 missense possibly damaging 0.88
R6084:Bora UTSW 14 99062294 missense possibly damaging 0.88
R6085:Bora UTSW 14 99062294 missense possibly damaging 0.88
R6086:Bora UTSW 14 99062294 missense possibly damaging 0.88
R6269:Bora UTSW 14 99073667 missense probably damaging 0.99
R7354:Bora UTSW 14 99047358 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCTCTGTTGCAAGGTGCC -3'
(R):5'- ACCCTGACTAAGACACTAGTACATTTG -3'

Sequencing Primer
(F):5'- ATCTCTGTTGCAAGGTGCCTTTTG -3'
(R):5'- ACCAAAGCGTTTATTTCCAACTGC -3'
Posted On2017-07-14