Incidental Mutation 'R6082:Ptk2'
ID 482256
Institutional Source Beutler Lab
Gene Symbol Ptk2
Ensembl Gene ENSMUSG00000022607
Gene Name PTK2 protein tyrosine kinase 2
Synonyms FAK, FRNK, Fadk
MMRRC Submission 044241-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6082 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 73076951-73295129 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 73148714 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 409 (M409K)
Ref Sequence ENSEMBL: ENSMUSP00000105663 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110036] [ENSMUST00000170939] [ENSMUST00000226988]
AlphaFold P34152
Predicted Effect probably damaging
Transcript: ENSMUST00000110036
AA Change: M409K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000105663
Gene: ENSMUSG00000022607
AA Change: M409K

DomainStartEndE-ValueType
B41 31 258 1.49e-39 SMART
Blast:B41 288 333 1e-19 BLAST
TyrKc 422 676 1.11e-130 SMART
low complexity region 686 698 N/A INTRINSIC
low complexity region 712 726 N/A INTRINSIC
low complexity region 863 883 N/A INTRINSIC
Pfam:Focal_AT 914 1046 5e-59 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000170939
AA Change: M409K

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000126764
Gene: ENSMUSG00000022607
AA Change: M409K

DomainStartEndE-ValueType
B41 31 258 1.49e-39 SMART
Blast:B41 287 333 1e-19 BLAST
TyrKc 422 676 1.11e-130 SMART
low complexity region 686 698 N/A INTRINSIC
low complexity region 712 726 N/A INTRINSIC
low complexity region 863 883 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226742
Predicted Effect probably damaging
Transcript: ENSMUST00000226988
AA Change: M409K

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227569
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228628
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein tyrosine kinase which is found concentrated in the focal adhesions that form between cells growing in the presence of extracellular matrix constituents. The encoded protein is a member of the FAK subfamily of protein tyrosine kinases but lacks significant sequence similarity to kinases from other subfamilies. Activation of this gene may be an important early step in cell growth and intracellular signal transduction pathways triggered in response to certain neural peptides or to cell interactions with the extracellular matrix. Several transcript variants encoding different isoforms have been found for this gene, but the full-length natures of only four of them have been determined. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a null allele die before or during organogenesis with growth retardation, abnormal embryonic and extra embryonic tissue development, and abnormal vascular development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik T C 1: 11,868,752 (GRCm39) I344T probably benign Het
Adamts19 G A 18: 59,101,846 (GRCm39) A639T probably benign Het
Adamts9 T C 6: 92,866,930 (GRCm39) D122G probably damaging Het
Bin2 A G 15: 100,543,029 (GRCm39) S358P possibly damaging Het
Bora A T 14: 99,299,730 (GRCm39) Q234L possibly damaging Het
Btaf1 C T 19: 36,960,942 (GRCm39) R772C probably damaging Het
Cenpf T C 1: 189,390,301 (GRCm39) E1177G probably benign Het
Clec4b2 A T 6: 123,181,100 (GRCm39) probably null Het
Dedd2 G A 7: 24,910,715 (GRCm39) P154S probably benign Het
Dennd5b A G 6: 148,970,193 (GRCm39) S87P probably damaging Het
Dhx8 C T 11: 101,655,139 (GRCm39) R1050W probably damaging Het
Eif3a T C 19: 60,760,568 (GRCm39) K682R possibly damaging Het
Eif4e2 G T 1: 87,153,956 (GRCm39) probably null Het
Ephb1 T C 9: 101,848,303 (GRCm39) D665G probably damaging Het
Gbp7 G A 3: 142,251,697 (GRCm39) V515M probably benign Het
Hnrnpdl C T 5: 100,184,340 (GRCm39) G398S probably null Het
Hook3 C A 8: 26,600,813 (GRCm39) A32S probably benign Het
Hoxb4 T C 11: 96,209,359 (GRCm39) probably benign Het
Idi1 T A 13: 8,940,506 (GRCm39) Y229* probably null Het
Lpl A T 8: 69,349,301 (GRCm39) I276F probably damaging Het
Ltbp4 T C 7: 27,035,105 (GRCm39) probably benign Het
Mphosph8 A G 14: 56,905,998 (GRCm39) I64V probably damaging Het
Mroh1 A G 15: 76,314,423 (GRCm39) D700G probably benign Het
Myt1l G A 12: 29,882,331 (GRCm39) G509R unknown Het
Myt1l T C 12: 29,892,518 (GRCm39) Y52H probably damaging Het
Nlrp9a T A 7: 26,267,402 (GRCm39) D777E probably benign Het
Nudt4 A G 10: 95,387,318 (GRCm39) I82T probably benign Het
Nwd2 T C 5: 63,962,374 (GRCm39) C653R possibly damaging Het
Obscn A G 11: 58,890,393 (GRCm39) Y7380H unknown Het
Or13a18 A G 7: 140,190,594 (GRCm39) T172A probably benign Het
Or8b3b C A 9: 38,583,866 (GRCm39) R291S probably damaging Het
Or8j3 A C 2: 86,028,661 (GRCm39) V145G probably damaging Het
Or8s8 C T 15: 98,354,647 (GRCm39) A152V probably damaging Het
Ptpn11 T C 5: 121,292,589 (GRCm39) T253A probably benign Het
Rabl6 C T 2: 25,473,837 (GRCm39) probably benign Het
Rnf14 T C 18: 38,434,723 (GRCm39) S57P possibly damaging Het
Scnm1 T C 3: 95,037,596 (GRCm39) I157V probably benign Het
Slco1b2 A C 6: 141,609,396 (GRCm39) I269L probably benign Het
Smchd1 A G 17: 71,656,714 (GRCm39) Y1918H probably benign Het
Spag17 A T 3: 100,031,501 (GRCm39) I2255F possibly damaging Het
Spata31g1 A G 4: 42,972,511 (GRCm39) M615V probably benign Het
Tnnt2 A G 1: 135,777,172 (GRCm39) M199V probably benign Het
Tymp GC GCC 15: 89,258,567 (GRCm39) probably null Het
Vmn2r73 T A 7: 85,507,429 (GRCm39) I628L probably benign Het
Zc2hc1b C A 10: 13,047,055 (GRCm39) E19* probably null Het
Other mutations in Ptk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00861:Ptk2 APN 15 73,134,396 (GRCm39) missense probably damaging 1.00
IGL00913:Ptk2 APN 15 73,167,238 (GRCm39) splice site probably benign
IGL01605:Ptk2 APN 15 73,136,188 (GRCm39) splice site probably benign
IGL01631:Ptk2 APN 15 73,088,220 (GRCm39) missense probably damaging 1.00
IGL01952:Ptk2 APN 15 73,101,780 (GRCm39) missense probably damaging 0.99
IGL01957:Ptk2 APN 15 73,114,322 (GRCm39) missense probably benign 0.05
IGL02441:Ptk2 APN 15 73,192,675 (GRCm39) missense probably benign 0.16
IGL02471:Ptk2 APN 15 73,170,036 (GRCm39) missense probably benign 0.41
IGL02621:Ptk2 APN 15 73,077,994 (GRCm39) missense probably damaging 0.99
IGL03198:Ptk2 APN 15 73,108,065 (GRCm39) missense probably damaging 1.00
Shooter UTSW 15 73,176,293 (GRCm39) missense possibly damaging 0.83
R0239:Ptk2 UTSW 15 73,215,132 (GRCm39) splice site probably null
R0239:Ptk2 UTSW 15 73,215,132 (GRCm39) splice site probably null
R1254:Ptk2 UTSW 15 73,101,819 (GRCm39) missense probably benign 0.01
R1291:Ptk2 UTSW 15 73,082,605 (GRCm39) missense probably damaging 1.00
R1307:Ptk2 UTSW 15 73,163,895 (GRCm39) missense probably benign 0.01
R1608:Ptk2 UTSW 15 73,134,424 (GRCm39) missense probably damaging 0.98
R1690:Ptk2 UTSW 15 73,134,459 (GRCm39) missense probably damaging 1.00
R1724:Ptk2 UTSW 15 73,114,255 (GRCm39) missense possibly damaging 0.58
R1725:Ptk2 UTSW 15 73,114,255 (GRCm39) missense possibly damaging 0.58
R1740:Ptk2 UTSW 15 73,114,255 (GRCm39) missense possibly damaging 0.58
R1741:Ptk2 UTSW 15 73,114,255 (GRCm39) missense possibly damaging 0.58
R1840:Ptk2 UTSW 15 73,082,733 (GRCm39) missense probably damaging 1.00
R1956:Ptk2 UTSW 15 73,087,832 (GRCm39) missense possibly damaging 0.49
R2022:Ptk2 UTSW 15 73,114,255 (GRCm39) missense possibly damaging 0.58
R2092:Ptk2 UTSW 15 73,108,040 (GRCm39) nonsense probably null
R2114:Ptk2 UTSW 15 73,114,255 (GRCm39) missense possibly damaging 0.58
R2115:Ptk2 UTSW 15 73,114,255 (GRCm39) missense possibly damaging 0.58
R2336:Ptk2 UTSW 15 73,137,965 (GRCm39) missense probably damaging 1.00
R2571:Ptk2 UTSW 15 73,103,768 (GRCm39) missense probably damaging 1.00
R4232:Ptk2 UTSW 15 73,181,698 (GRCm39) missense possibly damaging 0.61
R4245:Ptk2 UTSW 15 73,103,825 (GRCm39) missense probably benign 0.00
R4594:Ptk2 UTSW 15 73,078,045 (GRCm39) missense probably damaging 1.00
R4688:Ptk2 UTSW 15 73,078,074 (GRCm39) missense probably damaging 1.00
R4834:Ptk2 UTSW 15 73,087,945 (GRCm39) splice site probably null
R4847:Ptk2 UTSW 15 73,103,805 (GRCm39) missense probably benign
R5558:Ptk2 UTSW 15 73,176,294 (GRCm39) missense probably damaging 0.97
R5682:Ptk2 UTSW 15 73,134,413 (GRCm39) nonsense probably null
R5858:Ptk2 UTSW 15 73,192,944 (GRCm39) missense probably benign 0.12
R5951:Ptk2 UTSW 15 73,175,682 (GRCm39) missense possibly damaging 0.88
R6014:Ptk2 UTSW 15 73,176,293 (GRCm39) missense possibly damaging 0.83
R6027:Ptk2 UTSW 15 73,101,762 (GRCm39) missense probably damaging 1.00
R7025:Ptk2 UTSW 15 73,093,658 (GRCm39) missense possibly damaging 0.46
R7031:Ptk2 UTSW 15 73,093,658 (GRCm39) missense possibly damaging 0.46
R7032:Ptk2 UTSW 15 73,093,658 (GRCm39) missense possibly damaging 0.46
R7077:Ptk2 UTSW 15 73,093,658 (GRCm39) missense possibly damaging 0.46
R7078:Ptk2 UTSW 15 73,093,658 (GRCm39) missense possibly damaging 0.46
R7079:Ptk2 UTSW 15 73,093,658 (GRCm39) missense possibly damaging 0.46
R7090:Ptk2 UTSW 15 73,093,658 (GRCm39) missense possibly damaging 0.46
R7091:Ptk2 UTSW 15 73,093,658 (GRCm39) missense possibly damaging 0.46
R7092:Ptk2 UTSW 15 73,093,658 (GRCm39) missense possibly damaging 0.46
R7136:Ptk2 UTSW 15 73,093,658 (GRCm39) missense possibly damaging 0.46
R7137:Ptk2 UTSW 15 73,093,658 (GRCm39) missense possibly damaging 0.46
R7798:Ptk2 UTSW 15 73,167,224 (GRCm39) missense probably damaging 1.00
R8057:Ptk2 UTSW 15 73,170,048 (GRCm39) frame shift probably null
R8235:Ptk2 UTSW 15 73,215,140 (GRCm39) missense probably benign 0.00
R9106:Ptk2 UTSW 15 73,131,457 (GRCm39) missense possibly damaging 0.95
R9160:Ptk2 UTSW 15 73,087,933 (GRCm39) missense probably benign 0.01
R9301:Ptk2 UTSW 15 73,146,346 (GRCm39) missense probably damaging 1.00
R9448:Ptk2 UTSW 15 73,215,041 (GRCm39) missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- GCAAGCAATTCAGTGAGTGC -3'
(R):5'- CAGGATCTCCCTTTGAATTTTGTAGG -3'

Sequencing Primer
(F):5'- GCAAGCAATTCAGTGAGTGCATATAC -3'
(R):5'- AGGGCTTGATTAACATCCTACTGG -3'
Posted On 2017-07-14