Incidental Mutation 'R6082:Tymp'
ID 482258
Institutional Source Beutler Lab
Gene Symbol Tymp
Ensembl Gene ENSMUSG00000022615
Gene Name thymidine phosphorylase
Synonyms PDECGF, Ecgf1, gliostatin, Pdgfec, 2900072D10Rik, PD-ECGF
MMRRC Submission 044241-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6082 (G1)
Quality Score 217.468
Status Not validated
Chromosome 15
Chromosomal Location 89256134-89261242 bp(-) (GRCm39)
Type of Mutation frame shift
DNA Base Change (assembly) GC to GCC at 89258567 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000023285 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023285] [ENSMUST00000036987] [ENSMUST00000049968] [ENSMUST00000074552] [ENSMUST00000088717] [ENSMUST00000227834] [ENSMUST00000167643] [ENSMUST00000145259] [ENSMUST00000228111] [ENSMUST00000228977]
AlphaFold Q99N42
Predicted Effect probably null
Transcript: ENSMUST00000023285
SMART Domains Protein: ENSMUSP00000023285
Gene: ENSMUSG00000022615

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
Pfam:Glycos_trans_3N 23 85 1.5e-20 PFAM
Pfam:Glycos_transf_3 95 326 3.1e-50 PFAM
PYNP_C 374 448 6.46e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000036987
SMART Domains Protein: ENSMUSP00000036900
Gene: ENSMUSG00000008690

DomainStartEndE-ValueType
Pfam:DUF1032 20 576 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000049968
SMART Domains Protein: ENSMUSP00000053112
Gene: ENSMUSG00000047394

DomainStartEndE-ValueType
Pfam:SHIPPO-rpt 24 60 1.4e-4 PFAM
Pfam:SHIPPO-rpt 101 129 1.6e-3 PFAM
Pfam:SHIPPO-rpt 138 172 2.7e-6 PFAM
Pfam:SHIPPO-rpt 181 211 2.5e-5 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000074552
SMART Domains Protein: ENSMUSP00000074139
Gene: ENSMUSG00000008690

DomainStartEndE-ValueType
Pfam:DUF1032 51 607 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000088717
SMART Domains Protein: ENSMUSP00000086095
Gene: ENSMUSG00000008690

DomainStartEndE-ValueType
Pfam:CNDH2_N 11 123 1.2e-48 PFAM
Pfam:CNDH2_M 147 285 2.1e-20 PFAM
Pfam:CNDH2_C 308 598 1.9e-90 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134900
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136638
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147207
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147733
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140665
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151523
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227203
Predicted Effect probably benign
Transcript: ENSMUST00000227834
Predicted Effect probably benign
Transcript: ENSMUST00000167643
SMART Domains Protein: ENSMUSP00000131943
Gene: ENSMUSG00000091780

DomainStartEndE-ValueType
Pfam:SCO1-SenC 52 234 1.4e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227854
Predicted Effect probably benign
Transcript: ENSMUST00000145259
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228005
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226267
Predicted Effect probably benign
Transcript: ENSMUST00000228111
Predicted Effect probably benign
Transcript: ENSMUST00000228977
Meta Mutation Damage Score 0.9756 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an angiogenic factor which promotes angiogenesis in vivo and stimulates the in vitro growth of a variety of endothelial cells. It has a highly restricted target cell specificity acting only on endothelial cells. Mutations in this gene have been associated with mitochondrial neurogastrointestinal encephalomyopathy. Multiple alternatively spliced transcript variants have been identified. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit reduced thymidine phosphorylase activity and increased thymidine levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik T C 1: 11,868,752 (GRCm39) I344T probably benign Het
Adamts19 G A 18: 59,101,846 (GRCm39) A639T probably benign Het
Adamts9 T C 6: 92,866,930 (GRCm39) D122G probably damaging Het
Bin2 A G 15: 100,543,029 (GRCm39) S358P possibly damaging Het
Bora A T 14: 99,299,730 (GRCm39) Q234L possibly damaging Het
Btaf1 C T 19: 36,960,942 (GRCm39) R772C probably damaging Het
Cenpf T C 1: 189,390,301 (GRCm39) E1177G probably benign Het
Clec4b2 A T 6: 123,181,100 (GRCm39) probably null Het
Dedd2 G A 7: 24,910,715 (GRCm39) P154S probably benign Het
Dennd5b A G 6: 148,970,193 (GRCm39) S87P probably damaging Het
Dhx8 C T 11: 101,655,139 (GRCm39) R1050W probably damaging Het
Eif3a T C 19: 60,760,568 (GRCm39) K682R possibly damaging Het
Eif4e2 G T 1: 87,153,956 (GRCm39) probably null Het
Ephb1 T C 9: 101,848,303 (GRCm39) D665G probably damaging Het
Gbp7 G A 3: 142,251,697 (GRCm39) V515M probably benign Het
Hnrnpdl C T 5: 100,184,340 (GRCm39) G398S probably null Het
Hook3 C A 8: 26,600,813 (GRCm39) A32S probably benign Het
Hoxb4 T C 11: 96,209,359 (GRCm39) probably benign Het
Idi1 T A 13: 8,940,506 (GRCm39) Y229* probably null Het
Lpl A T 8: 69,349,301 (GRCm39) I276F probably damaging Het
Ltbp4 T C 7: 27,035,105 (GRCm39) probably benign Het
Mphosph8 A G 14: 56,905,998 (GRCm39) I64V probably damaging Het
Mroh1 A G 15: 76,314,423 (GRCm39) D700G probably benign Het
Myt1l G A 12: 29,882,331 (GRCm39) G509R unknown Het
Myt1l T C 12: 29,892,518 (GRCm39) Y52H probably damaging Het
Nlrp9a T A 7: 26,267,402 (GRCm39) D777E probably benign Het
Nudt4 A G 10: 95,387,318 (GRCm39) I82T probably benign Het
Nwd2 T C 5: 63,962,374 (GRCm39) C653R possibly damaging Het
Obscn A G 11: 58,890,393 (GRCm39) Y7380H unknown Het
Or13a18 A G 7: 140,190,594 (GRCm39) T172A probably benign Het
Or8b3b C A 9: 38,583,866 (GRCm39) R291S probably damaging Het
Or8j3 A C 2: 86,028,661 (GRCm39) V145G probably damaging Het
Or8s8 C T 15: 98,354,647 (GRCm39) A152V probably damaging Het
Ptk2 A T 15: 73,148,714 (GRCm39) M409K probably damaging Het
Ptpn11 T C 5: 121,292,589 (GRCm39) T253A probably benign Het
Rabl6 C T 2: 25,473,837 (GRCm39) probably benign Het
Rnf14 T C 18: 38,434,723 (GRCm39) S57P possibly damaging Het
Scnm1 T C 3: 95,037,596 (GRCm39) I157V probably benign Het
Slco1b2 A C 6: 141,609,396 (GRCm39) I269L probably benign Het
Smchd1 A G 17: 71,656,714 (GRCm39) Y1918H probably benign Het
Spag17 A T 3: 100,031,501 (GRCm39) I2255F possibly damaging Het
Spata31g1 A G 4: 42,972,511 (GRCm39) M615V probably benign Het
Tnnt2 A G 1: 135,777,172 (GRCm39) M199V probably benign Het
Vmn2r73 T A 7: 85,507,429 (GRCm39) I628L probably benign Het
Zc2hc1b C A 10: 13,047,055 (GRCm39) E19* probably null Het
Other mutations in Tymp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01013:Tymp APN 15 89,260,513 (GRCm39) missense probably damaging 1.00
IGL03355:Tymp APN 15 89,259,219 (GRCm39) missense possibly damaging 0.80
PIT4142001:Tymp UTSW 15 89,260,548 (GRCm39) missense probably damaging 1.00
R0791:Tymp UTSW 15 89,259,021 (GRCm39) missense probably damaging 1.00
R2219:Tymp UTSW 15 89,258,965 (GRCm39) missense probably benign
R2266:Tymp UTSW 15 89,258,011 (GRCm39) missense probably damaging 1.00
R2267:Tymp UTSW 15 89,258,011 (GRCm39) missense probably damaging 1.00
R2268:Tymp UTSW 15 89,258,011 (GRCm39) missense probably damaging 1.00
R4714:Tymp UTSW 15 89,260,510 (GRCm39) missense probably damaging 1.00
R5247:Tymp UTSW 15 89,258,567 (GRCm39) frame shift probably null
R5248:Tymp UTSW 15 89,258,567 (GRCm39) frame shift probably null
R5249:Tymp UTSW 15 89,258,567 (GRCm39) frame shift probably null
R5741:Tymp UTSW 15 89,260,639 (GRCm39) missense probably benign 0.18
R5810:Tymp UTSW 15 89,258,534 (GRCm39) missense probably damaging 0.99
R5960:Tymp UTSW 15 89,260,778 (GRCm39) critical splice donor site probably null
R6083:Tymp UTSW 15 89,258,567 (GRCm39) frame shift probably null
R6085:Tymp UTSW 15 89,258,567 (GRCm39) frame shift probably null
R6566:Tymp UTSW 15 89,257,803 (GRCm39) missense probably benign
R6869:Tymp UTSW 15 89,260,894 (GRCm39) missense probably benign
R6969:Tymp UTSW 15 89,258,251 (GRCm39) missense probably benign 0.04
R7019:Tymp UTSW 15 89,260,484 (GRCm39) splice site probably null
Z1177:Tymp UTSW 15 89,259,767 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCAGAAGCTGCAGGGATTGAG -3'
(R):5'- CCAATCAAAGCTGTCCTGACTG -3'

Sequencing Primer
(F):5'- ATTGAGAGCTCCTGGCATAC -3'
(R):5'- ACTGCGGACCTGGGGAAATC -3'
Posted On 2017-07-14