Incidental Mutation 'R6082:Bin2'
ID 482260
Institutional Source Beutler Lab
Gene Symbol Bin2
Ensembl Gene ENSMUSG00000098112
Gene Name bridging integrator 2
Synonyms
MMRRC Submission 044241-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6082 (G1)
Quality Score 158.009
Status Not validated
Chromosome 15
Chromosomal Location 100538963-100567384 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 100543029 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 358 (S358P)
Ref Sequence ENSEMBL: ENSMUSP00000138158 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000182068] [ENSMUST00000182574] [ENSMUST00000182775] [ENSMUST00000182814] [ENSMUST00000183211]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000182068
SMART Domains Protein: ENSMUSP00000138316
Gene: ENSMUSG00000098112

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
Pfam:BAR 17 98 5.8e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182494
Predicted Effect probably benign
Transcript: ENSMUST00000182574
SMART Domains Protein: ENSMUSP00000138102
Gene: ENSMUSG00000098112

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
Pfam:BAR 17 150 1.2e-25 PFAM
low complexity region 162 210 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182775
AA Change: S353P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000138673
Gene: ENSMUSG00000098112
AA Change: S353P

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
BAR 16 205 2.92e-51 SMART
low complexity region 220 270 N/A INTRINSIC
low complexity region 292 321 N/A INTRINSIC
low complexity region 342 353 N/A INTRINSIC
low complexity region 393 409 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000182814
AA Change: S358P

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000138158
Gene: ENSMUSG00000098112
AA Change: S358P

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
BAR 16 210 3.28e-54 SMART
low complexity region 225 275 N/A INTRINSIC
low complexity region 297 326 N/A INTRINSIC
low complexity region 347 358 N/A INTRINSIC
low complexity region 398 414 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183193
Predicted Effect probably benign
Transcript: ENSMUST00000183211
AA Change: S385P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000138523
Gene: ENSMUSG00000098112
AA Change: S385P

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
BAR 16 237 2.32e-77 SMART
low complexity region 252 302 N/A INTRINSIC
low complexity region 324 353 N/A INTRINSIC
low complexity region 374 385 N/A INTRINSIC
low complexity region 425 441 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183874
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik T C 1: 11,868,752 (GRCm39) I344T probably benign Het
Adamts19 G A 18: 59,101,846 (GRCm39) A639T probably benign Het
Adamts9 T C 6: 92,866,930 (GRCm39) D122G probably damaging Het
Bora A T 14: 99,299,730 (GRCm39) Q234L possibly damaging Het
Btaf1 C T 19: 36,960,942 (GRCm39) R772C probably damaging Het
Cenpf T C 1: 189,390,301 (GRCm39) E1177G probably benign Het
Clec4b2 A T 6: 123,181,100 (GRCm39) probably null Het
Dedd2 G A 7: 24,910,715 (GRCm39) P154S probably benign Het
Dennd5b A G 6: 148,970,193 (GRCm39) S87P probably damaging Het
Dhx8 C T 11: 101,655,139 (GRCm39) R1050W probably damaging Het
Eif3a T C 19: 60,760,568 (GRCm39) K682R possibly damaging Het
Eif4e2 G T 1: 87,153,956 (GRCm39) probably null Het
Ephb1 T C 9: 101,848,303 (GRCm39) D665G probably damaging Het
Gbp7 G A 3: 142,251,697 (GRCm39) V515M probably benign Het
Hnrnpdl C T 5: 100,184,340 (GRCm39) G398S probably null Het
Hook3 C A 8: 26,600,813 (GRCm39) A32S probably benign Het
Hoxb4 T C 11: 96,209,359 (GRCm39) probably benign Het
Idi1 T A 13: 8,940,506 (GRCm39) Y229* probably null Het
Lpl A T 8: 69,349,301 (GRCm39) I276F probably damaging Het
Ltbp4 T C 7: 27,035,105 (GRCm39) probably benign Het
Mphosph8 A G 14: 56,905,998 (GRCm39) I64V probably damaging Het
Mroh1 A G 15: 76,314,423 (GRCm39) D700G probably benign Het
Myt1l G A 12: 29,882,331 (GRCm39) G509R unknown Het
Myt1l T C 12: 29,892,518 (GRCm39) Y52H probably damaging Het
Nlrp9a T A 7: 26,267,402 (GRCm39) D777E probably benign Het
Nudt4 A G 10: 95,387,318 (GRCm39) I82T probably benign Het
Nwd2 T C 5: 63,962,374 (GRCm39) C653R possibly damaging Het
Obscn A G 11: 58,890,393 (GRCm39) Y7380H unknown Het
Or13a18 A G 7: 140,190,594 (GRCm39) T172A probably benign Het
Or8b3b C A 9: 38,583,866 (GRCm39) R291S probably damaging Het
Or8j3 A C 2: 86,028,661 (GRCm39) V145G probably damaging Het
Or8s8 C T 15: 98,354,647 (GRCm39) A152V probably damaging Het
Ptk2 A T 15: 73,148,714 (GRCm39) M409K probably damaging Het
Ptpn11 T C 5: 121,292,589 (GRCm39) T253A probably benign Het
Rabl6 C T 2: 25,473,837 (GRCm39) probably benign Het
Rnf14 T C 18: 38,434,723 (GRCm39) S57P possibly damaging Het
Scnm1 T C 3: 95,037,596 (GRCm39) I157V probably benign Het
Slco1b2 A C 6: 141,609,396 (GRCm39) I269L probably benign Het
Smchd1 A G 17: 71,656,714 (GRCm39) Y1918H probably benign Het
Spag17 A T 3: 100,031,501 (GRCm39) I2255F possibly damaging Het
Spata31g1 A G 4: 42,972,511 (GRCm39) M615V probably benign Het
Tnnt2 A G 1: 135,777,172 (GRCm39) M199V probably benign Het
Tymp GC GCC 15: 89,258,567 (GRCm39) probably null Het
Vmn2r73 T A 7: 85,507,429 (GRCm39) I628L probably benign Het
Zc2hc1b C A 10: 13,047,055 (GRCm39) E19* probably null Het
Other mutations in Bin2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4852:Bin2 UTSW 15 100,543,169 (GRCm39) missense probably damaging 0.96
R5150:Bin2 UTSW 15 100,543,244 (GRCm39) missense probably damaging 0.96
R5236:Bin2 UTSW 15 100,560,415 (GRCm39) missense probably damaging 1.00
R5418:Bin2 UTSW 15 100,547,027 (GRCm39) missense probably damaging 1.00
R5502:Bin2 UTSW 15 100,543,286 (GRCm39) missense probably benign 0.02
R5993:Bin2 UTSW 15 100,542,901 (GRCm39) frame shift probably null
R6550:Bin2 UTSW 15 100,543,358 (GRCm39) missense probably benign 0.41
R6650:Bin2 UTSW 15 100,567,301 (GRCm39) missense probably damaging 1.00
R6665:Bin2 UTSW 15 100,554,676 (GRCm39) missense probably damaging 1.00
R7618:Bin2 UTSW 15 100,542,894 (GRCm39) missense probably damaging 0.99
R9169:Bin2 UTSW 15 100,554,631 (GRCm39) missense possibly damaging 0.79
R9573:Bin2 UTSW 15 100,560,433 (GRCm39) missense probably damaging 1.00
R9632:Bin2 UTSW 15 100,549,915 (GRCm39) missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TGTGAAGAACCCTCTGGAGAG -3'
(R):5'- CAGCTGTGAGAGTCAAGAGTC -3'

Sequencing Primer
(F):5'- AGAACCCTCTGGAGAGCCTGG -3'
(R):5'- CTGTGAGAGTCAAGAGTCCTTAAAG -3'
Posted On 2017-07-14