Mutagenetix > Incidental Mutation

Incidental Mutation 'R6082:Smchd1'

482261

Institutional Source

Beutler Lab

Gene Symbol

Smchd1

Ensembl Gene

ENSMUSG00000024054

Gene Name

SMC hinge domain containing 1

Synonyms

4931400A14Rik, MommeD1

MMRRC Submission

044241-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.842) question?

Stock #

R6082 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

71344489-71475343 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 71349719 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 1918 (Y1918H)

Ref Sequence

ENSEMBL: ENSMUSP00000121835 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000127430]

AlphaFold

Q6P5D8

Predicted Effect

probably benign
Transcript: ENSMUST00000127430
AA Change: Y1918H

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000121835
Gene: ENSMUSG00000024054
AA Change: Y1918H

Domain	Start	End	E-Value	Type
Pfam:HATPase_c_3	139	299	6.8e-16	PFAM
low complexity region	451	457	N/A	INTRINSIC
internal_repeat_1	859	1087	9.1e-5	PROSPERO
low complexity region	1185	1196	N/A	INTRINSIC
internal_repeat_1	1205	1409	9.1e-5	PROSPERO
coiled coil region	1649	1680	N/A	INTRINSIC
SMC_hinge	1721	1848	1.64e-15	SMART
low complexity region	1940	1954	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138193

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147111

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000180743

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182049

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182205

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains a hinge region domain found in members of the SMC (structural maintenance of chromosomes) protein family. [provided by RefSeq, Dec 2011]
PHENOTYPE: Females homozygous for an ENU-induced allele die at midgestation showing placental defects and hypomethylation at X-linked genes that are normally subject to X-inactivation, whereas homozygous males are viable. Females homozygous for a gene trap allele die before E13.5, whereas males remain healthy. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700022I11Rik	A	G	4: 42,972,511	M615V	probably benign	Het
A830018L16Rik	T	C	1: 11,798,528	I344T	probably benign	Het
Adamts19	G	A	18: 58,968,774	A639T	probably benign	Het
Adamts9	T	C	6: 92,889,949	D122G	probably damaging	Het
Bin2	A	G	15: 100,645,148	S358P	possibly damaging	Het
Bora	A	T	14: 99,062,294	Q234L	possibly damaging	Het
Btaf1	C	T	19: 36,983,542	R772C	probably damaging	Het
Cenpf	T	C	1: 189,658,104	E1177G	probably benign	Het
Clec4b2	A	T	6: 123,204,141		probably null	Het
Dedd2	G	A	7: 25,211,290	P154S	probably benign	Het
Dennd5b	A	G	6: 149,068,695	S87P	probably damaging	Het
Dhx8	C	T	11: 101,764,313	R1050W	probably damaging	Het
Eif3a	T	C	19: 60,772,130	K682R	possibly damaging	Het
Eif4e2	G	T	1: 87,226,234		probably null	Het
Ephb1	T	C	9: 101,971,104	D665G	probably damaging	Het
Gbp7	G	A	3: 142,545,936	V515M	probably benign	Het
Hnrnpdl	C	T	5: 100,036,481	G398S	probably null	Het
Hook3	C	A	8: 26,110,785	A32S	probably benign	Het
Hoxb4	T	C	11: 96,318,533		probably benign	Het
Idi1	T	A	13: 8,890,470	Y229*	probably null	Het
Lpl	A	T	8: 68,896,649	I276F	probably damaging	Het
Ltbp4	T	C	7: 27,335,680		probably benign	Het
Mphosph8	A	G	14: 56,668,541	I64V	probably damaging	Het
Mroh1	A	G	15: 76,430,223	D700G	probably benign	Het
Myt1l	G	A	12: 29,832,332	G509R	unknown	Het
Myt1l	T	C	12: 29,842,519	Y52H	probably damaging	Het
Nlrp9a	T	A	7: 26,567,977	D777E	probably benign	Het
Nudt4	A	G	10: 95,551,456	I82T	probably benign	Het
Nwd2	T	C	5: 63,805,031	C653R	possibly damaging	Het
Obscn	A	G	11: 58,999,567	Y7380H	unknown	Het
Olfr1045	A	C	2: 86,198,317	V145G	probably damaging	Het
Olfr281	C	T	15: 98,456,766	A152V	probably damaging	Het
Olfr46	A	G	7: 140,610,681	T172A	probably benign	Het
Olfr918	C	A	9: 38,672,570	R291S	probably damaging	Het
Ptk2	A	T	15: 73,276,865	M409K	probably damaging	Het
Ptpn11	T	C	5: 121,154,526	T253A	probably benign	Het
Rabl6	C	T	2: 25,583,825		probably benign	Het
Rnf14	T	C	18: 38,301,670	S57P	possibly damaging	Het
Scnm1	T	C	3: 95,130,285	I157V	probably benign	Het
Slco1b2	A	C	6: 141,663,670	I269L	probably benign	Het
Spag17	A	T	3: 100,124,185	I2255F	possibly damaging	Het
Tnnt2	A	G	1: 135,849,434	M199V	probably benign	Het
Tymp	GC	GCC	15: 89,374,364		probably null	Het
Vmn2r73	T	A	7: 85,858,221	I628L	probably benign	Het
Zc2hc1b	C	A	10: 13,171,311	E19*	probably null	Het

Other mutations in Smchd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00162:Smchd1	APN	17	71465673	splice site	probably benign
IGL00529:Smchd1	APN	17	71394799	missense	probably benign	0.30
IGL00642:Smchd1	APN	17	71390432	missense	probably damaging	1.00
IGL00821:Smchd1	APN	17	71398623	missense	possibly damaging	0.92
IGL01330:Smchd1	APN	17	71436788	missense	probably benign
IGL01432:Smchd1	APN	17	71431290	missense	probably damaging	1.00
IGL01473:Smchd1	APN	17	71389750	missense	probably benign	0.00
IGL01705:Smchd1	APN	17	71381398	missense	probably damaging	1.00
IGL01787:Smchd1	APN	17	71391418	missense	probably damaging	0.99
IGL01814:Smchd1	APN	17	71378187	missense	probably benign	0.01
IGL01976:Smchd1	APN	17	71394725	nonsense	probably null
IGL01995:Smchd1	APN	17	71444020	missense	probably damaging	0.98
IGL02090:Smchd1	APN	17	71431253	missense	possibly damaging	0.86
IGL02302:Smchd1	APN	17	71358133	splice site	probably benign
IGL02309:Smchd1	APN	17	71443903	missense	probably benign	0.32
IGL02391:Smchd1	APN	17	71431259	missense	probably null	1.00
IGL02515:Smchd1	APN	17	71440957	missense	probably damaging	1.00
IGL02644:Smchd1	APN	17	71360021	splice site	probably benign
IGL03081:Smchd1	APN	17	71360191	missense	probably damaging	0.98
IGL03212:Smchd1	APN	17	71443891	missense	probably damaging	0.99
IGL03236:Smchd1	APN	17	71391430	missense	possibly damaging	0.88
IGL03297:Smchd1	APN	17	71349700	missense	probably benign	0.01
Dry_tortugas	UTSW	17	71440956	missense	probably damaging	1.00
R0049:Smchd1	UTSW	17	71431236	missense	probably benign	0.01
R0254:Smchd1	UTSW	17	71411891	missense	probably benign	0.00
R0391:Smchd1	UTSW	17	71403154	missense	probably damaging	1.00
R0403:Smchd1	UTSW	17	71394902	missense	probably damaging	1.00
R0499:Smchd1	UTSW	17	71387088	missense	probably benign
R0520:Smchd1	UTSW	17	71429543	missense	possibly damaging	0.85
R0616:Smchd1	UTSW	17	71379574	missense	probably benign	0.39
R1120:Smchd1	UTSW	17	71358146	nonsense	probably null
R1469:Smchd1	UTSW	17	71349730	missense	probably damaging	1.00
R1469:Smchd1	UTSW	17	71349730	missense	probably damaging	1.00
R1473:Smchd1	UTSW	17	71361837	splice site	probably benign
R1484:Smchd1	UTSW	17	71378257	missense	probably benign	0.31
R1501:Smchd1	UTSW	17	71365094	missense	possibly damaging	0.54
R1718:Smchd1	UTSW	17	71448833	missense	possibly damaging	0.46
R1765:Smchd1	UTSW	17	71400201	splice site	probably benign
R1766:Smchd1	UTSW	17	71391379	missense	probably damaging	0.99
R1803:Smchd1	UTSW	17	71387006	missense	probably damaging	0.99
R1829:Smchd1	UTSW	17	71370337	missense	probably damaging	1.00
R1850:Smchd1	UTSW	17	71389771	missense	probably damaging	0.99
R1917:Smchd1	UTSW	17	71407237	missense	possibly damaging	0.48
R1918:Smchd1	UTSW	17	71407237	missense	possibly damaging	0.48
R1936:Smchd1	UTSW	17	71463791	missense	probably damaging	1.00
R2024:Smchd1	UTSW	17	71370928	missense	probably benign	0.15
R2147:Smchd1	UTSW	17	71398588	missense	possibly damaging	0.93
R2180:Smchd1	UTSW	17	71463799	missense	probably benign	0.23
R2398:Smchd1	UTSW	17	71360141	missense	probably damaging	1.00
R2398:Smchd1	UTSW	17	71426436	splice site	probably benign
R2935:Smchd1	UTSW	17	71411905	missense	probably damaging	1.00
R3000:Smchd1	UTSW	17	71363038	missense	probably benign	0.00
R3021:Smchd1	UTSW	17	71387098	missense	possibly damaging	0.75
R3808:Smchd1	UTSW	17	71429541	missense	probably damaging	1.00
R4323:Smchd1	UTSW	17	71428275	missense	probably benign	0.00
R4486:Smchd1	UTSW	17	71407235	missense	probably benign	0.02
R4487:Smchd1	UTSW	17	71407235	missense	probably benign	0.02
R4488:Smchd1	UTSW	17	71407235	missense	probably benign	0.02
R4489:Smchd1	UTSW	17	71407235	missense	probably benign	0.02
R4723:Smchd1	UTSW	17	71436747	nonsense	probably null
R4751:Smchd1	UTSW	17	71391468	missense	probably benign	0.01
R4798:Smchd1	UTSW	17	71360053	nonsense	probably null
R4814:Smchd1	UTSW	17	71411768	critical splice donor site	probably null
R4882:Smchd1	UTSW	17	71358239	intron	probably benign
R5088:Smchd1	UTSW	17	71431348	missense	possibly damaging	0.86
R5589:Smchd1	UTSW	17	71440961	missense	probably damaging	1.00
R5618:Smchd1	UTSW	17	71455727	missense	probably damaging	1.00
R5839:Smchd1	UTSW	17	71394862	missense	probably damaging	0.98
R5994:Smchd1	UTSW	17	71365409	missense	possibly damaging	0.89
R6009:Smchd1	UTSW	17	71440956	missense	probably damaging	1.00
R6042:Smchd1	UTSW	17	71377057	nonsense	probably null
R6126:Smchd1	UTSW	17	71370285	missense	probably damaging	1.00
R6294:Smchd1	UTSW	17	71370927	missense	probably benign	0.13
R6788:Smchd1	UTSW	17	71475101	missense	probably benign	0.02
R6853:Smchd1	UTSW	17	71436743	missense	probably damaging	1.00
R6875:Smchd1	UTSW	17	71353506	missense	probably damaging	1.00
R7026:Smchd1	UTSW	17	71349667	missense	probably benign
R7045:Smchd1	UTSW	17	71415044	missense	probably benign	0.22
R7068:Smchd1	UTSW	17	71387092	missense	probably benign	0.00
R7085:Smchd1	UTSW	17	71365219	splice site	probably null
R7089:Smchd1	UTSW	17	71361960	missense	probably benign	0.00
R7145:Smchd1	UTSW	17	71378207	missense	probably benign
R7158:Smchd1	UTSW	17	71400150	missense	probably damaging	0.99
R7180:Smchd1	UTSW	17	71394823	missense	probably damaging	0.99
R7183:Smchd1	UTSW	17	71353516	missense	probably benign	0.00
R7214:Smchd1	UTSW	17	71345364	missense	probably benign	0.15
R7414:Smchd1	UTSW	17	71475079	missense	probably damaging	0.99
R7512:Smchd1	UTSW	17	71381369	missense	possibly damaging	0.51
R7631:Smchd1	UTSW	17	71398689	missense	probably benign	0.10
R7641:Smchd1	UTSW	17	71390479	missense	probably benign	0.00
R7709:Smchd1	UTSW	17	71358198	missense	probably damaging	1.00
R7768:Smchd1	UTSW	17	71411911	missense	probably damaging	1.00
R7789:Smchd1	UTSW	17	71475301	start gained	probably benign
R7898:Smchd1	UTSW	17	71377818	splice site	probably null
R7965:Smchd1	UTSW	17	71455626	missense	possibly damaging	0.65
R8177:Smchd1	UTSW	17	71390453	missense	probably benign	0.28
R8359:Smchd1	UTSW	17	71431243	missense	probably damaging	0.99
R8370:Smchd1	UTSW	17	71394913	missense	probably benign	0.22
R8426:Smchd1	UTSW	17	71448603	missense	probably damaging	1.00
R8443:Smchd1	UTSW	17	71407249	missense	probably benign	0.18
R8948:Smchd1	UTSW	17	71436772	missense	probably damaging	1.00
R8954:Smchd1	UTSW	17	71448757	missense	probably damaging	1.00
R9041:Smchd1	UTSW	17	71394715	critical splice donor site	probably null
R9054:Smchd1	UTSW	17	71363022	nonsense	probably null
R9141:Smchd1	UTSW	17	71365130	missense	probably benign	0.00
R9169:Smchd1	UTSW	17	71415664	missense	probably damaging	1.00
R9231:Smchd1	UTSW	17	71365089	missense	probably benign	0.05
R9368:Smchd1	UTSW	17	71387076	missense	probably damaging	1.00
R9374:Smchd1	UTSW	17	71411848	missense	possibly damaging	0.61
R9416:Smchd1	UTSW	17	71394796	missense	probably benign	0.27
R9426:Smchd1	UTSW	17	71365130	missense	probably benign	0.00
R9491:Smchd1	UTSW	17	71360025	critical splice donor site	probably null
R9511:Smchd1	UTSW	17	71443904	missense	possibly damaging	0.65
R9591:Smchd1	UTSW	17	71394833	missense	probably damaging	1.00
R9593:Smchd1	UTSW	17	71394833	missense	probably damaging	1.00
Z1176:Smchd1	UTSW	17	71361841	missense	probably null	1.00

Predicted Primers

PCR Primer
(F):5'- ACTCATCAATGTTCACCGTCAAG -3'
(R):5'- CATTGAAACTTCATTCCTCACACAG -3'

Sequencing Primer
(F):5'- TGTTCACCGTCAAGCAAAAAGTTC -3'
(R):5'- CTCCCAAGTTACTTAGTGATG -3'

Posted On

2017-07-14