Incidental Mutation 'R6082:Rnf14'
ID 482262
Institutional Source Beutler Lab
Gene Symbol Rnf14
Ensembl Gene ENSMUSG00000060450
Gene Name ring finger protein 14
Synonyms 2310075C09Rik, 2610005D23Rik, Triad2, D18Ertd188e, D7Bwg0165e
MMRRC Submission 044241-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.741) question?
Stock # R6082 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 38417590-38450902 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 38434723 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 57 (S57P)
Ref Sequence ENSEMBL: ENSMUSP00000126205 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072376] [ENSMUST00000170811] [ENSMUST00000171461]
AlphaFold Q9JI90
Predicted Effect possibly damaging
Transcript: ENSMUST00000072376
AA Change: S57P

PolyPhen 2 Score 0.689 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000072212
Gene: ENSMUSG00000060450
AA Change: S57P

DomainStartEndE-ValueType
RWD 11 137 2.36e-32 SMART
low complexity region 169 179 N/A INTRINSIC
RING 221 266 6.51e-2 SMART
IBR 290 351 3.15e-18 SMART
IBR 387 454 2.11e-1 SMART
low complexity region 470 485 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158671
Predicted Effect probably benign
Transcript: ENSMUST00000170811
SMART Domains Protein: ENSMUSP00000133070
Gene: ENSMUSG00000060450

DomainStartEndE-ValueType
low complexity region 43 53 N/A INTRINSIC
RING 95 140 6.51e-2 SMART
IBR 164 225 3.15e-18 SMART
IBR 261 328 2.11e-1 SMART
low complexity region 344 359 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000171461
AA Change: S57P

PolyPhen 2 Score 0.689 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000126205
Gene: ENSMUSG00000060450
AA Change: S57P

DomainStartEndE-ValueType
RWD 11 137 2.36e-32 SMART
low complexity region 169 179 N/A INTRINSIC
RING 221 266 6.51e-2 SMART
IBR 290 351 3.15e-18 SMART
IBR 387 454 2.11e-1 SMART
low complexity region 470 485 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a RING zinc finger, a motif known to be involved in protein-protein interactions. This protein interacts with androgen receptor (AR) and may function as a coactivator that induces AR target gene expression in prostate. A dominant negative mutant of this gene has been demonstrated to inhibit the AR-mediated growth of prostate cancer. This protein also interacts with class III ubiquitin-conjugating enzymes (E2s) and may act as a ubiquitin-ligase (E3) in the ubiquitination of certain nuclear proteins. Six alternatively spliced transcript variants encoding two distinct isoforms have been reported. [provided by RefSeq, Jan 2011]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik T C 1: 11,868,752 (GRCm39) I344T probably benign Het
Adamts19 G A 18: 59,101,846 (GRCm39) A639T probably benign Het
Adamts9 T C 6: 92,866,930 (GRCm39) D122G probably damaging Het
Bin2 A G 15: 100,543,029 (GRCm39) S358P possibly damaging Het
Bora A T 14: 99,299,730 (GRCm39) Q234L possibly damaging Het
Btaf1 C T 19: 36,960,942 (GRCm39) R772C probably damaging Het
Cenpf T C 1: 189,390,301 (GRCm39) E1177G probably benign Het
Clec4b2 A T 6: 123,181,100 (GRCm39) probably null Het
Dedd2 G A 7: 24,910,715 (GRCm39) P154S probably benign Het
Dennd5b A G 6: 148,970,193 (GRCm39) S87P probably damaging Het
Dhx8 C T 11: 101,655,139 (GRCm39) R1050W probably damaging Het
Eif3a T C 19: 60,760,568 (GRCm39) K682R possibly damaging Het
Eif4e2 G T 1: 87,153,956 (GRCm39) probably null Het
Ephb1 T C 9: 101,848,303 (GRCm39) D665G probably damaging Het
Gbp7 G A 3: 142,251,697 (GRCm39) V515M probably benign Het
Hnrnpdl C T 5: 100,184,340 (GRCm39) G398S probably null Het
Hook3 C A 8: 26,600,813 (GRCm39) A32S probably benign Het
Hoxb4 T C 11: 96,209,359 (GRCm39) probably benign Het
Idi1 T A 13: 8,940,506 (GRCm39) Y229* probably null Het
Lpl A T 8: 69,349,301 (GRCm39) I276F probably damaging Het
Ltbp4 T C 7: 27,035,105 (GRCm39) probably benign Het
Mphosph8 A G 14: 56,905,998 (GRCm39) I64V probably damaging Het
Mroh1 A G 15: 76,314,423 (GRCm39) D700G probably benign Het
Myt1l G A 12: 29,882,331 (GRCm39) G509R unknown Het
Myt1l T C 12: 29,892,518 (GRCm39) Y52H probably damaging Het
Nlrp9a T A 7: 26,267,402 (GRCm39) D777E probably benign Het
Nudt4 A G 10: 95,387,318 (GRCm39) I82T probably benign Het
Nwd2 T C 5: 63,962,374 (GRCm39) C653R possibly damaging Het
Obscn A G 11: 58,890,393 (GRCm39) Y7380H unknown Het
Or13a18 A G 7: 140,190,594 (GRCm39) T172A probably benign Het
Or8b3b C A 9: 38,583,866 (GRCm39) R291S probably damaging Het
Or8j3 A C 2: 86,028,661 (GRCm39) V145G probably damaging Het
Or8s8 C T 15: 98,354,647 (GRCm39) A152V probably damaging Het
Ptk2 A T 15: 73,148,714 (GRCm39) M409K probably damaging Het
Ptpn11 T C 5: 121,292,589 (GRCm39) T253A probably benign Het
Rabl6 C T 2: 25,473,837 (GRCm39) probably benign Het
Scnm1 T C 3: 95,037,596 (GRCm39) I157V probably benign Het
Slco1b2 A C 6: 141,609,396 (GRCm39) I269L probably benign Het
Smchd1 A G 17: 71,656,714 (GRCm39) Y1918H probably benign Het
Spag17 A T 3: 100,031,501 (GRCm39) I2255F possibly damaging Het
Spata31g1 A G 4: 42,972,511 (GRCm39) M615V probably benign Het
Tnnt2 A G 1: 135,777,172 (GRCm39) M199V probably benign Het
Tymp GC GCC 15: 89,258,567 (GRCm39) probably null Het
Vmn2r73 T A 7: 85,507,429 (GRCm39) I628L probably benign Het
Zc2hc1b C A 10: 13,047,055 (GRCm39) E19* probably null Het
Other mutations in Rnf14
AlleleSourceChrCoordTypePredicted EffectPPH Score
Aloft UTSW 18 38,441,435 (GRCm39) missense probably damaging 1.00
souffle UTSW 18 38,442,629 (GRCm39) missense probably damaging 1.00
R1682:Rnf14 UTSW 18 38,441,242 (GRCm39) missense probably benign 0.00
R2299:Rnf14 UTSW 18 38,441,138 (GRCm39) missense probably benign 0.03
R4246:Rnf14 UTSW 18 38,434,701 (GRCm39) splice site probably null
R4941:Rnf14 UTSW 18 38,441,435 (GRCm39) missense probably damaging 1.00
R5056:Rnf14 UTSW 18 38,441,441 (GRCm39) missense probably damaging 1.00
R7070:Rnf14 UTSW 18 38,434,781 (GRCm39) missense possibly damaging 0.66
R7772:Rnf14 UTSW 18 38,442,629 (GRCm39) missense probably damaging 1.00
R8903:Rnf14 UTSW 18 38,446,267 (GRCm39) missense probably benign 0.02
R9393:Rnf14 UTSW 18 38,442,680 (GRCm39) missense possibly damaging 0.91
RF014:Rnf14 UTSW 18 38,442,623 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACCTAAGTAGATTTTCAAGGGC -3'
(R):5'- GCACTGAATTAAAGATCACCAAGG -3'

Sequencing Primer
(F):5'- GTAGATTTTCAAGGGCTTAAAAGGTG -3'
(R):5'- CTGAATTAAAGATCACCAAGGTAGTC -3'
Posted On 2017-07-14