Mutagenetix > Incidental Mutation

Incidental Mutation 'R6082:Adamts19'

482263

Institutional Source

Beutler Lab

Gene Symbol

Adamts19

Ensembl Gene

ENSMUSG00000053441

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 19

Synonyms

D230034E10Rik

MMRRC Submission

044241-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6082 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

58836764-59053678 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 58968774 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Threonine at position 639 (A639T)

Ref Sequence

ENSEMBL: ENSMUSP00000050535 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000052907]

AlphaFold

P59509

Predicted Effect

probably benign
Transcript: ENSMUST00000052907
AA Change: A639T

PolyPhen 2 Score 0.176 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000050535
Gene: ENSMUSG00000053441
AA Change: A639T

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
low complexity region	57	84	N/A	INTRINSIC
low complexity region	109	124	N/A	INTRINSIC
Pfam:Pep_M12B_propep	131	276	1.6e-21	PFAM
Pfam:Reprolysin_5	326	523	1.7e-13	PFAM
Pfam:Reprolysin_4	328	544	2e-10	PFAM
Pfam:Reprolysin	328	548	9e-22	PFAM
Pfam:Reprolysin_2	346	537	1.6e-9	PFAM
Pfam:Reprolysin_3	350	496	3.4e-12	PFAM
low complexity region	551	562	N/A	INTRINSIC
TSP1	639	689	5.68e-9	SMART
Pfam:ADAM_spacer1	793	903	1.1e-31	PFAM
TSP1	922	980	4.95e-2	SMART
TSP1	982	1040	4.95e-2	SMART
TSP1	1042	1086	1.62e-4	SMART
TSP1	1093	1147	1.03e-6	SMART
Pfam:PLAC	1167	1199	4.2e-9	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. This gene is predominantly expressed in the ovary with lower levels of expression observed in kidney, heart, skeletal muscle, lung and testis. The encoded preproprotein undergoes proteolytic processing to generate an active protease. [provided by RefSeq, Jul 2016]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700022I11Rik	A	G	4: 42,972,511	M615V	probably benign	Het
A830018L16Rik	T	C	1: 11,798,528	I344T	probably benign	Het
Adamts9	T	C	6: 92,889,949	D122G	probably damaging	Het
Bin2	A	G	15: 100,645,148	S358P	possibly damaging	Het
Bora	A	T	14: 99,062,294	Q234L	possibly damaging	Het
Btaf1	C	T	19: 36,983,542	R772C	probably damaging	Het
Cenpf	T	C	1: 189,658,104	E1177G	probably benign	Het
Clec4b2	A	T	6: 123,204,141		probably null	Het
Dedd2	G	A	7: 25,211,290	P154S	probably benign	Het
Dennd5b	A	G	6: 149,068,695	S87P	probably damaging	Het
Dhx8	C	T	11: 101,764,313	R1050W	probably damaging	Het
Eif3a	T	C	19: 60,772,130	K682R	possibly damaging	Het
Eif4e2	G	T	1: 87,226,234		probably null	Het
Ephb1	T	C	9: 101,971,104	D665G	probably damaging	Het
Gbp7	G	A	3: 142,545,936	V515M	probably benign	Het
Hnrnpdl	C	T	5: 100,036,481	G398S	probably null	Het
Hook3	C	A	8: 26,110,785	A32S	probably benign	Het
Hoxb4	T	C	11: 96,318,533		probably benign	Het
Idi1	T	A	13: 8,890,470	Y229*	probably null	Het
Lpl	A	T	8: 68,896,649	I276F	probably damaging	Het
Ltbp4	T	C	7: 27,335,680		probably benign	Het
Mphosph8	A	G	14: 56,668,541	I64V	probably damaging	Het
Mroh1	A	G	15: 76,430,223	D700G	probably benign	Het
Myt1l	G	A	12: 29,832,332	G509R	unknown	Het
Myt1l	T	C	12: 29,842,519	Y52H	probably damaging	Het
Nlrp9a	T	A	7: 26,567,977	D777E	probably benign	Het
Nudt4	A	G	10: 95,551,456	I82T	probably benign	Het
Nwd2	T	C	5: 63,805,031	C653R	possibly damaging	Het
Obscn	A	G	11: 58,999,567	Y7380H	unknown	Het
Olfr1045	A	C	2: 86,198,317	V145G	probably damaging	Het
Olfr281	C	T	15: 98,456,766	A152V	probably damaging	Het
Olfr46	A	G	7: 140,610,681	T172A	probably benign	Het
Olfr918	C	A	9: 38,672,570	R291S	probably damaging	Het
Ptk2	A	T	15: 73,276,865	M409K	probably damaging	Het
Ptpn11	T	C	5: 121,154,526	T253A	probably benign	Het
Rabl6	C	T	2: 25,583,825		probably benign	Het
Rnf14	T	C	18: 38,301,670	S57P	possibly damaging	Het
Scnm1	T	C	3: 95,130,285	I157V	probably benign	Het
Slco1b2	A	C	6: 141,663,670	I269L	probably benign	Het
Smchd1	A	G	17: 71,349,719	Y1918H	probably benign	Het
Spag17	A	T	3: 100,124,185	I2255F	possibly damaging	Het
Tnnt2	A	G	1: 135,849,434	M199V	probably benign	Het
Tymp	GC	GCC	15: 89,374,364		probably null	Het
Vmn2r73	T	A	7: 85,858,221	I628L	probably benign	Het
Zc2hc1b	C	A	10: 13,171,311	E19*	probably null	Het

Other mutations in Adamts19

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00156:Adamts19	APN	18	59024465	missense	probably damaging	1.00
IGL00331:Adamts19	APN	18	59007325	splice site	probably benign
IGL00970:Adamts19	APN	18	59011077	missense	possibly damaging	0.82
IGL01328:Adamts19	APN	18	59048882	missense	possibly damaging	0.89
IGL01385:Adamts19	APN	18	58972779	missense	probably damaging	0.98
IGL01529:Adamts19	APN	18	58963463	missense	probably damaging	0.99
IGL01535:Adamts19	APN	18	58968819	missense	probably benign	0.00
IGL01557:Adamts19	APN	18	58968720	splice site	probably null
IGL01705:Adamts19	APN	18	59032966	missense	possibly damaging	0.91
IGL01803:Adamts19	APN	18	58952469	missense	probably damaging	1.00
IGL02116:Adamts19	APN	18	58837499	missense	probably benign
IGL02131:Adamts19	APN	18	59052660	missense	probably damaging	1.00
IGL02312:Adamts19	APN	18	58927297	missense	probably damaging	1.00
IGL02755:Adamts19	APN	18	58969933	missense	probably benign	0.25
IGL02866:Adamts19	APN	18	59048842	missense	possibly damaging	0.80
IGL02964:Adamts19	APN	18	58988965	missense	probably damaging	1.00
IGL02982:Adamts19	APN	18	59024518	missense	probably damaging	1.00
IGL03040:Adamts19	APN	18	58903008	missense	probably benign	0.05
R0081:Adamts19	UTSW	18	58903065	critical splice donor site	probably null
R0194:Adamts19	UTSW	18	59011148	missense	probably null	1.00
R0195:Adamts19	UTSW	18	58969870	splice site	probably benign
R0541:Adamts19	UTSW	18	58927300	critical splice donor site	probably null
R0659:Adamts19	UTSW	18	59007493	splice site	probably benign
R0967:Adamts19	UTSW	18	58972740	nonsense	probably null
R1512:Adamts19	UTSW	18	59048845	missense	possibly damaging	0.89
R1536:Adamts19	UTSW	18	59052615	missense	probably damaging	1.00
R1582:Adamts19	UTSW	18	58969941	missense	probably damaging	0.98
R1629:Adamts19	UTSW	18	58954619	missense	probably damaging	0.97
R1653:Adamts19	UTSW	18	58890293	missense	probably benign	0.00
R1718:Adamts19	UTSW	18	58972825	missense	probably damaging	1.00
R1733:Adamts19	UTSW	18	59031929	missense	probably damaging	1.00
R1753:Adamts19	UTSW	18	59007372	missense	possibly damaging	0.78
R1776:Adamts19	UTSW	18	58954620	missense	probably damaging	1.00
R1905:Adamts19	UTSW	18	59032945	missense	possibly damaging	0.92
R1958:Adamts19	UTSW	18	58970006	missense	probably benign	0.09
R1994:Adamts19	UTSW	18	58972831	critical splice donor site	probably null
R2177:Adamts19	UTSW	18	58954554	missense	possibly damaging	0.66
R3730:Adamts19	UTSW	18	58900910	missense	probably damaging	1.00
R4342:Adamts19	UTSW	18	58942500	missense	probably damaging	1.00
R4772:Adamts19	UTSW	18	58837776	missense	possibly damaging	0.85
R4822:Adamts19	UTSW	18	58890284	missense	probably damaging	1.00
R4891:Adamts19	UTSW	18	59033000	missense	probably damaging	1.00
R5112:Adamts19	UTSW	18	59031804	nonsense	probably null
R5116:Adamts19	UTSW	18	58902994	missense	possibly damaging	0.52
R5205:Adamts19	UTSW	18	58968808	missense	probably damaging	1.00
R5765:Adamts19	UTSW	18	59052582	missense	probably damaging	1.00
R5781:Adamts19	UTSW	18	58837968	missense	possibly damaging	0.59
R5792:Adamts19	UTSW	18	58837512	missense	possibly damaging	0.49
R6088:Adamts19	UTSW	18	58902102	missense	probably damaging	1.00
R7060:Adamts19	UTSW	18	58837640	nonsense	probably null
R7251:Adamts19	UTSW	18	58837902	missense	probably damaging	1.00
R7295:Adamts19	UTSW	18	58837883	missense	probably damaging	1.00
R7974:Adamts19	UTSW	18	59011022	missense	possibly damaging	0.72
R7991:Adamts19	UTSW	18	59052654	missense	probably damaging	1.00
R8129:Adamts19	UTSW	18	59007487	critical splice donor site	probably null
R8297:Adamts19	UTSW	18	58837848	missense	probably damaging	1.00
R8336:Adamts19	UTSW	18	59007372	missense	possibly damaging	0.78
R8358:Adamts19	UTSW	18	59048809	missense	probably damaging	1.00
R8864:Adamts19	UTSW	18	58890425	nonsense	probably null
R9051:Adamts19	UTSW	18	58900976	missense	probably damaging	1.00
R9253:Adamts19	UTSW	18	58969941	missense	probably damaging	0.98
R9423:Adamts19	UTSW	18	58890355	missense	possibly damaging	0.89
R9610:Adamts19	UTSW	18	58890327	missense	probably benign	0.26
R9611:Adamts19	UTSW	18	58890327	missense	probably benign	0.26
R9686:Adamts19	UTSW	18	58838021	missense	probably benign	0.00
R9697:Adamts19	UTSW	18	58968762	missense	probably damaging	0.99
R9747:Adamts19	UTSW	18	58890415	missense	possibly damaging	0.69
Z1177:Adamts19	UTSW	18	58838075	missense	probably damaging	1.00
Z1177:Adamts19	UTSW	18	58890374	missense	possibly damaging	0.47

Predicted Primers

PCR Primer
(F):5'- TGGACCTTAATGTTGGAAGTGC -3'
(R):5'- AAGCCTGATCACTGTTTGCTTC -3'

Sequencing Primer
(F):5'- GACCTTAATGTTGGAAGTGCTAACTC -3'
(R):5'- CACTGTTTGCTTCTTAAAGGAGACG -3'

Posted On

2017-07-14