Incidental Mutation 'R6082:Adamts19'
ID482263
Institutional Source Beutler Lab
Gene Symbol Adamts19
Ensembl Gene ENSMUSG00000053441
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 19
SynonymsD230034E10Rik
MMRRC Submission 044241-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6082 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location58836764-59053678 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 58968774 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 639 (A639T)
Ref Sequence ENSEMBL: ENSMUSP00000050535 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052907]
Predicted Effect probably benign
Transcript: ENSMUST00000052907
AA Change: A639T

PolyPhen 2 Score 0.176 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000050535
Gene: ENSMUSG00000053441
AA Change: A639T

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 57 84 N/A INTRINSIC
low complexity region 109 124 N/A INTRINSIC
Pfam:Pep_M12B_propep 131 276 1.6e-21 PFAM
Pfam:Reprolysin_5 326 523 1.7e-13 PFAM
Pfam:Reprolysin_4 328 544 2e-10 PFAM
Pfam:Reprolysin 328 548 9e-22 PFAM
Pfam:Reprolysin_2 346 537 1.6e-9 PFAM
Pfam:Reprolysin_3 350 496 3.4e-12 PFAM
low complexity region 551 562 N/A INTRINSIC
TSP1 639 689 5.68e-9 SMART
Pfam:ADAM_spacer1 793 903 1.1e-31 PFAM
TSP1 922 980 4.95e-2 SMART
TSP1 982 1040 4.95e-2 SMART
TSP1 1042 1086 1.62e-4 SMART
TSP1 1093 1147 1.03e-6 SMART
Pfam:PLAC 1167 1199 4.2e-9 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. This gene is predominantly expressed in the ovary with lower levels of expression observed in kidney, heart, skeletal muscle, lung and testis. The encoded preproprotein undergoes proteolytic processing to generate an active protease. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A G 4: 42,972,511 M615V probably benign Het
A830018L16Rik T C 1: 11,798,528 I344T probably benign Het
Adamts9 T C 6: 92,889,949 D122G probably damaging Het
Bin2 A G 15: 100,645,148 S358P possibly damaging Het
Bora A T 14: 99,062,294 Q234L possibly damaging Het
Btaf1 C T 19: 36,983,542 R772C probably damaging Het
Cenpf T C 1: 189,658,104 E1177G probably benign Het
Clec4b2 A T 6: 123,204,141 probably null Het
Dedd2 G A 7: 25,211,290 P154S probably benign Het
Dennd5b A G 6: 149,068,695 S87P probably damaging Het
Dhx8 C T 11: 101,764,313 R1050W probably damaging Het
Eif3a T C 19: 60,772,130 K682R possibly damaging Het
Eif4e2 G T 1: 87,226,234 probably null Het
Ephb1 T C 9: 101,971,104 D665G probably damaging Het
Gbp7 G A 3: 142,545,936 V515M probably benign Het
Hnrnpdl C T 5: 100,036,481 G398S probably null Het
Hook3 C A 8: 26,110,785 A32S probably benign Het
Hoxb4 T C 11: 96,318,533 probably benign Het
Idi1 T A 13: 8,890,470 Y229* probably null Het
Lpl A T 8: 68,896,649 I276F probably damaging Het
Ltbp4 T C 7: 27,335,680 probably benign Het
Mphosph8 A G 14: 56,668,541 I64V probably damaging Het
Mroh1 A G 15: 76,430,223 D700G probably benign Het
Myt1l G A 12: 29,832,332 G509R unknown Het
Myt1l T C 12: 29,842,519 Y52H probably damaging Het
Nlrp9a T A 7: 26,567,977 D777E probably benign Het
Nudt4 A G 10: 95,551,456 I82T probably benign Het
Nwd2 T C 5: 63,805,031 C653R possibly damaging Het
Obscn A G 11: 58,999,567 Y7380H unknown Het
Olfr1045 A C 2: 86,198,317 V145G probably damaging Het
Olfr281 C T 15: 98,456,766 A152V probably damaging Het
Olfr46 A G 7: 140,610,681 T172A probably benign Het
Olfr918 C A 9: 38,672,570 R291S probably damaging Het
Ptk2 A T 15: 73,276,865 M409K probably damaging Het
Ptpn11 T C 5: 121,154,526 T253A probably benign Het
Rabl6 C T 2: 25,583,825 probably benign Het
Rnf14 T C 18: 38,301,670 S57P possibly damaging Het
Scnm1 T C 3: 95,130,285 I157V probably benign Het
Slco1b2 A C 6: 141,663,670 I269L probably benign Het
Smchd1 A G 17: 71,349,719 Y1918H probably benign Het
Spag17 A T 3: 100,124,185 I2255F possibly damaging Het
Tnnt2 A G 1: 135,849,434 M199V probably benign Het
Tymp GC GCC 15: 89,374,364 probably null Het
Vmn2r73 T A 7: 85,858,221 I628L probably benign Het
Zc2hc1b C A 10: 13,171,311 E19* probably null Het
Other mutations in Adamts19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Adamts19 APN 18 59024465 missense probably damaging 1.00
IGL00331:Adamts19 APN 18 59007325 splice site probably benign
IGL00970:Adamts19 APN 18 59011077 missense possibly damaging 0.82
IGL01328:Adamts19 APN 18 59048882 missense possibly damaging 0.89
IGL01385:Adamts19 APN 18 58972779 missense probably damaging 0.98
IGL01529:Adamts19 APN 18 58963463 missense probably damaging 0.99
IGL01535:Adamts19 APN 18 58968819 missense probably benign 0.00
IGL01557:Adamts19 APN 18 58968720 splice site probably null
IGL01705:Adamts19 APN 18 59032966 missense possibly damaging 0.91
IGL01803:Adamts19 APN 18 58952469 missense probably damaging 1.00
IGL02116:Adamts19 APN 18 58837499 missense probably benign
IGL02131:Adamts19 APN 18 59052660 missense probably damaging 1.00
IGL02312:Adamts19 APN 18 58927297 missense probably damaging 1.00
IGL02755:Adamts19 APN 18 58969933 missense probably benign 0.25
IGL02866:Adamts19 APN 18 59048842 missense possibly damaging 0.80
IGL02964:Adamts19 APN 18 58988965 missense probably damaging 1.00
IGL02982:Adamts19 APN 18 59024518 missense probably damaging 1.00
IGL03040:Adamts19 APN 18 58903008 missense probably benign 0.05
R0081:Adamts19 UTSW 18 58903065 critical splice donor site probably null
R0194:Adamts19 UTSW 18 59011148 missense probably null 1.00
R0195:Adamts19 UTSW 18 58969870 splice site probably benign
R0541:Adamts19 UTSW 18 58927300 critical splice donor site probably null
R0659:Adamts19 UTSW 18 59007493 splice site probably benign
R0967:Adamts19 UTSW 18 58972740 nonsense probably null
R1512:Adamts19 UTSW 18 59048845 missense possibly damaging 0.89
R1536:Adamts19 UTSW 18 59052615 missense probably damaging 1.00
R1582:Adamts19 UTSW 18 58969941 missense probably damaging 0.98
R1629:Adamts19 UTSW 18 58954619 missense probably damaging 0.97
R1653:Adamts19 UTSW 18 58890293 missense probably benign 0.00
R1718:Adamts19 UTSW 18 58972825 missense probably damaging 1.00
R1733:Adamts19 UTSW 18 59031929 missense probably damaging 1.00
R1753:Adamts19 UTSW 18 59007372 missense possibly damaging 0.78
R1776:Adamts19 UTSW 18 58954620 missense probably damaging 1.00
R1905:Adamts19 UTSW 18 59032945 missense possibly damaging 0.92
R1958:Adamts19 UTSW 18 58970006 missense probably benign 0.09
R1994:Adamts19 UTSW 18 58972831 critical splice donor site probably null
R2177:Adamts19 UTSW 18 58954554 missense possibly damaging 0.66
R3730:Adamts19 UTSW 18 58900910 missense probably damaging 1.00
R4342:Adamts19 UTSW 18 58942500 missense probably damaging 1.00
R4772:Adamts19 UTSW 18 58837776 missense possibly damaging 0.85
R4822:Adamts19 UTSW 18 58890284 missense probably damaging 1.00
R4891:Adamts19 UTSW 18 59033000 missense probably damaging 1.00
R5112:Adamts19 UTSW 18 59031804 nonsense probably null
R5116:Adamts19 UTSW 18 58902994 missense possibly damaging 0.52
R5205:Adamts19 UTSW 18 58968808 missense probably damaging 1.00
R5765:Adamts19 UTSW 18 59052582 missense probably damaging 1.00
R5781:Adamts19 UTSW 18 58837968 missense possibly damaging 0.59
R5792:Adamts19 UTSW 18 58837512 missense possibly damaging 0.49
R6088:Adamts19 UTSW 18 58902102 missense probably damaging 1.00
R7060:Adamts19 UTSW 18 58837640 nonsense probably null
R7251:Adamts19 UTSW 18 58837902 missense probably damaging 1.00
R7295:Adamts19 UTSW 18 58837883 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGACCTTAATGTTGGAAGTGC -3'
(R):5'- AAGCCTGATCACTGTTTGCTTC -3'

Sequencing Primer
(F):5'- GACCTTAATGTTGGAAGTGCTAACTC -3'
(R):5'- CACTGTTTGCTTCTTAAAGGAGACG -3'
Posted On2017-07-14