Incidental Mutation 'R6082:Btaf1'
ID 482264
Institutional Source Beutler Lab
Gene Symbol Btaf1
Ensembl Gene ENSMUSG00000040565
Gene Name B-TFIID TATA-box binding protein associated factor 1
Synonyms E430027O22Rik
MMRRC Submission 044241-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.967) question?
Stock # R6082 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 36903479-36990152 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 36960942 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 772 (R772C)
Ref Sequence ENSEMBL: ENSMUSP00000097093 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099494]
AlphaFold E9QAE3
Predicted Effect probably damaging
Transcript: ENSMUST00000099494
AA Change: R772C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097093
Gene: ENSMUSG00000040565
AA Change: R772C

DomainStartEndE-ValueType
low complexity region 87 98 N/A INTRINSIC
low complexity region 143 152 N/A INTRINSIC
PDB:3OC3|B 276 414 3e-6 PDB
low complexity region 438 454 N/A INTRINSIC
Pfam:DUF3535 585 1051 1.1e-133 PFAM
low complexity region 1099 1110 N/A INTRINSIC
low complexity region 1177 1192 N/A INTRINSIC
DEXDc 1261 1469 3.02e-30 SMART
low complexity region 1630 1641 N/A INTRINSIC
HELICc 1657 1743 2.22e-19 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a TAF (TATA box-binding protein-associated factor), which associates with TBP (TATA box-binding protein) to form the B-TFIID complex that is required for transcription initiation of genes by RNA polymerase II. This TAF has DNA-dependent ATPase activity, which drives the dissociation of TBP from DNA, freeing the TBP to associate with other TATA boxes or TATA-less promoters. [provided by RefSeq, Sep 2011]
PHENOTYPE: Embryos homozygous for a gene-trapped allele display growth retardation. Embryos homozygous for an ENU-induced allele show growth retardation, edema, abnormal blood circulation, myocardial trabeculae hypoplasia, and delayed head and brain development. [provided by MGI curators]
Allele List at MGI

All alleles(40) : Gene trapped(40)

Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik T C 1: 11,868,752 (GRCm39) I344T probably benign Het
Adamts19 G A 18: 59,101,846 (GRCm39) A639T probably benign Het
Adamts9 T C 6: 92,866,930 (GRCm39) D122G probably damaging Het
Bin2 A G 15: 100,543,029 (GRCm39) S358P possibly damaging Het
Bora A T 14: 99,299,730 (GRCm39) Q234L possibly damaging Het
Cenpf T C 1: 189,390,301 (GRCm39) E1177G probably benign Het
Clec4b2 A T 6: 123,181,100 (GRCm39) probably null Het
Dedd2 G A 7: 24,910,715 (GRCm39) P154S probably benign Het
Dennd5b A G 6: 148,970,193 (GRCm39) S87P probably damaging Het
Dhx8 C T 11: 101,655,139 (GRCm39) R1050W probably damaging Het
Eif3a T C 19: 60,760,568 (GRCm39) K682R possibly damaging Het
Eif4e2 G T 1: 87,153,956 (GRCm39) probably null Het
Ephb1 T C 9: 101,848,303 (GRCm39) D665G probably damaging Het
Gbp7 G A 3: 142,251,697 (GRCm39) V515M probably benign Het
Hnrnpdl C T 5: 100,184,340 (GRCm39) G398S probably null Het
Hook3 C A 8: 26,600,813 (GRCm39) A32S probably benign Het
Hoxb4 T C 11: 96,209,359 (GRCm39) probably benign Het
Idi1 T A 13: 8,940,506 (GRCm39) Y229* probably null Het
Lpl A T 8: 69,349,301 (GRCm39) I276F probably damaging Het
Ltbp4 T C 7: 27,035,105 (GRCm39) probably benign Het
Mphosph8 A G 14: 56,905,998 (GRCm39) I64V probably damaging Het
Mroh1 A G 15: 76,314,423 (GRCm39) D700G probably benign Het
Myt1l G A 12: 29,882,331 (GRCm39) G509R unknown Het
Myt1l T C 12: 29,892,518 (GRCm39) Y52H probably damaging Het
Nlrp9a T A 7: 26,267,402 (GRCm39) D777E probably benign Het
Nudt4 A G 10: 95,387,318 (GRCm39) I82T probably benign Het
Nwd2 T C 5: 63,962,374 (GRCm39) C653R possibly damaging Het
Obscn A G 11: 58,890,393 (GRCm39) Y7380H unknown Het
Or13a18 A G 7: 140,190,594 (GRCm39) T172A probably benign Het
Or8b3b C A 9: 38,583,866 (GRCm39) R291S probably damaging Het
Or8j3 A C 2: 86,028,661 (GRCm39) V145G probably damaging Het
Or8s8 C T 15: 98,354,647 (GRCm39) A152V probably damaging Het
Ptk2 A T 15: 73,148,714 (GRCm39) M409K probably damaging Het
Ptpn11 T C 5: 121,292,589 (GRCm39) T253A probably benign Het
Rabl6 C T 2: 25,473,837 (GRCm39) probably benign Het
Rnf14 T C 18: 38,434,723 (GRCm39) S57P possibly damaging Het
Scnm1 T C 3: 95,037,596 (GRCm39) I157V probably benign Het
Slco1b2 A C 6: 141,609,396 (GRCm39) I269L probably benign Het
Smchd1 A G 17: 71,656,714 (GRCm39) Y1918H probably benign Het
Spag17 A T 3: 100,031,501 (GRCm39) I2255F possibly damaging Het
Spata31g1 A G 4: 42,972,511 (GRCm39) M615V probably benign Het
Tnnt2 A G 1: 135,777,172 (GRCm39) M199V probably benign Het
Tymp GC GCC 15: 89,258,567 (GRCm39) probably null Het
Vmn2r73 T A 7: 85,507,429 (GRCm39) I628L probably benign Het
Zc2hc1b C A 10: 13,047,055 (GRCm39) E19* probably null Het
Other mutations in Btaf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Btaf1 APN 19 36,987,102 (GRCm39) missense probably damaging 1.00
IGL00535:Btaf1 APN 19 36,974,935 (GRCm39) missense probably damaging 1.00
IGL00574:Btaf1 APN 19 36,947,330 (GRCm39) missense probably benign 0.00
IGL00969:Btaf1 APN 19 36,988,652 (GRCm39) splice site probably benign
IGL01325:Btaf1 APN 19 36,982,049 (GRCm39) splice site probably benign
IGL01399:Btaf1 APN 19 36,977,570 (GRCm39) nonsense probably null
IGL02024:Btaf1 APN 19 36,969,826 (GRCm39) splice site probably benign
IGL02471:Btaf1 APN 19 36,977,592 (GRCm39) missense probably damaging 0.96
IGL02664:Btaf1 APN 19 36,955,828 (GRCm39) splice site probably benign
IGL02898:Btaf1 APN 19 36,946,468 (GRCm39) missense probably benign
IGL02995:Btaf1 APN 19 36,958,535 (GRCm39) splice site probably benign
IGL03023:Btaf1 APN 19 36,987,415 (GRCm39) missense possibly damaging 0.85
IGL03188:Btaf1 APN 19 36,926,508 (GRCm39) missense possibly damaging 0.91
IGL03353:Btaf1 APN 19 36,969,900 (GRCm39) missense probably damaging 1.00
freudenberg UTSW 19 36,965,573 (GRCm39) critical splice donor site probably null
Galanos UTSW 19 36,926,502 (GRCm39) missense probably damaging 1.00
3-1:Btaf1 UTSW 19 36,987,478 (GRCm39) missense probably damaging 1.00
R0013:Btaf1 UTSW 19 36,935,773 (GRCm39) missense probably benign
R0048:Btaf1 UTSW 19 36,980,924 (GRCm39) missense probably benign 0.01
R0117:Btaf1 UTSW 19 36,947,368 (GRCm39) missense probably benign 0.06
R0207:Btaf1 UTSW 19 36,987,048 (GRCm39) nonsense probably null
R0310:Btaf1 UTSW 19 36,981,934 (GRCm39) missense probably damaging 0.96
R0377:Btaf1 UTSW 19 36,966,402 (GRCm39) missense probably benign
R0419:Btaf1 UTSW 19 36,922,629 (GRCm39) missense probably damaging 0.99
R0440:Btaf1 UTSW 19 36,964,053 (GRCm39) missense probably damaging 0.99
R0532:Btaf1 UTSW 19 36,928,586 (GRCm39) splice site probably benign
R0612:Btaf1 UTSW 19 36,946,537 (GRCm39) missense probably damaging 0.99
R0731:Btaf1 UTSW 19 36,974,895 (GRCm39) splice site probably null
R0780:Btaf1 UTSW 19 36,966,322 (GRCm39) missense probably damaging 0.99
R0919:Btaf1 UTSW 19 36,968,143 (GRCm39) missense probably benign 0.03
R1104:Btaf1 UTSW 19 36,982,002 (GRCm39) missense probably damaging 1.00
R1263:Btaf1 UTSW 19 36,933,924 (GRCm39) missense probably benign 0.10
R1325:Btaf1 UTSW 19 36,946,562 (GRCm39) missense possibly damaging 0.68
R1447:Btaf1 UTSW 19 36,969,854 (GRCm39) missense probably benign 0.00
R1554:Btaf1 UTSW 19 36,973,998 (GRCm39) missense probably benign 0.02
R1649:Btaf1 UTSW 19 36,959,122 (GRCm39) missense probably benign
R1715:Btaf1 UTSW 19 36,946,521 (GRCm39) missense probably damaging 0.99
R1733:Btaf1 UTSW 19 36,972,362 (GRCm39) missense probably benign
R1764:Btaf1 UTSW 19 36,928,518 (GRCm39) missense probably benign 0.12
R1874:Btaf1 UTSW 19 36,957,983 (GRCm39) missense probably benign
R1911:Btaf1 UTSW 19 36,964,030 (GRCm39) missense probably benign
R1933:Btaf1 UTSW 19 36,950,357 (GRCm39) missense probably damaging 1.00
R2080:Btaf1 UTSW 19 36,928,548 (GRCm39) missense probably benign 0.09
R2483:Btaf1 UTSW 19 36,958,486 (GRCm39) missense probably benign 0.02
R2510:Btaf1 UTSW 19 36,979,845 (GRCm39) missense probably benign 0.08
R3623:Btaf1 UTSW 19 36,958,486 (GRCm39) missense probably benign 0.02
R3624:Btaf1 UTSW 19 36,958,486 (GRCm39) missense probably benign 0.02
R3801:Btaf1 UTSW 19 36,966,373 (GRCm39) missense probably benign 0.00
R3801:Btaf1 UTSW 19 36,963,948 (GRCm39) missense probably benign
R3802:Btaf1 UTSW 19 36,966,373 (GRCm39) missense probably benign 0.00
R3802:Btaf1 UTSW 19 36,963,948 (GRCm39) missense probably benign
R3803:Btaf1 UTSW 19 36,966,373 (GRCm39) missense probably benign 0.00
R3803:Btaf1 UTSW 19 36,963,948 (GRCm39) missense probably benign
R4077:Btaf1 UTSW 19 36,963,879 (GRCm39) missense probably benign 0.00
R4079:Btaf1 UTSW 19 36,963,879 (GRCm39) missense probably benign 0.00
R4133:Btaf1 UTSW 19 36,939,138 (GRCm39) missense probably benign 0.00
R4673:Btaf1 UTSW 19 36,955,772 (GRCm39) missense probably benign 0.00
R4731:Btaf1 UTSW 19 36,958,478 (GRCm39) missense probably benign 0.03
R4796:Btaf1 UTSW 19 36,933,828 (GRCm39) missense possibly damaging 0.95
R4824:Btaf1 UTSW 19 36,958,448 (GRCm39) missense possibly damaging 0.84
R4835:Btaf1 UTSW 19 36,979,858 (GRCm39) missense probably benign 0.00
R4837:Btaf1 UTSW 19 36,944,185 (GRCm39) missense probably benign
R4925:Btaf1 UTSW 19 36,988,733 (GRCm39) missense probably benign
R4968:Btaf1 UTSW 19 36,947,351 (GRCm39) missense probably null 0.71
R4976:Btaf1 UTSW 19 36,963,979 (GRCm39) missense probably benign
R5001:Btaf1 UTSW 19 36,964,052 (GRCm39) missense possibly damaging 0.90
R5037:Btaf1 UTSW 19 36,980,931 (GRCm39) missense probably damaging 1.00
R5039:Btaf1 UTSW 19 36,968,162 (GRCm39) missense probably benign
R5211:Btaf1 UTSW 19 36,973,962 (GRCm39) missense probably benign 0.32
R5422:Btaf1 UTSW 19 36,928,507 (GRCm39) missense probably benign 0.09
R5429:Btaf1 UTSW 19 36,972,257 (GRCm39) missense possibly damaging 0.58
R5530:Btaf1 UTSW 19 36,968,175 (GRCm39) missense possibly damaging 0.85
R5582:Btaf1 UTSW 19 36,965,573 (GRCm39) critical splice donor site probably null
R5654:Btaf1 UTSW 19 36,961,015 (GRCm39) missense probably benign 0.35
R5744:Btaf1 UTSW 19 36,981,890 (GRCm39) missense probably benign 0.02
R6243:Btaf1 UTSW 19 36,958,520 (GRCm39) missense probably benign 0.02
R6291:Btaf1 UTSW 19 36,950,408 (GRCm39) missense probably benign 0.00
R6502:Btaf1 UTSW 19 36,961,017 (GRCm39) missense probably benign
R7034:Btaf1 UTSW 19 36,981,869 (GRCm39) missense probably benign
R7036:Btaf1 UTSW 19 36,981,869 (GRCm39) missense probably benign
R7085:Btaf1 UTSW 19 36,950,318 (GRCm39) missense probably benign
R7097:Btaf1 UTSW 19 36,926,502 (GRCm39) missense probably damaging 1.00
R7248:Btaf1 UTSW 19 36,922,714 (GRCm39) missense possibly damaging 0.54
R7386:Btaf1 UTSW 19 36,935,782 (GRCm39) missense probably benign 0.02
R7402:Btaf1 UTSW 19 36,980,915 (GRCm39) missense probably damaging 1.00
R7452:Btaf1 UTSW 19 36,946,527 (GRCm39) missense probably damaging 1.00
R7493:Btaf1 UTSW 19 36,987,005 (GRCm39) missense probably damaging 1.00
R7513:Btaf1 UTSW 19 36,955,803 (GRCm39) missense probably benign 0.30
R7888:Btaf1 UTSW 19 36,943,036 (GRCm39) missense probably benign 0.10
R7944:Btaf1 UTSW 19 36,926,565 (GRCm39) missense probably benign
R8062:Btaf1 UTSW 19 36,969,865 (GRCm39) missense probably benign 0.00
R8559:Btaf1 UTSW 19 36,964,273 (GRCm39) missense probably benign 0.00
R8793:Btaf1 UTSW 19 36,958,429 (GRCm39) missense probably benign 0.21
R8855:Btaf1 UTSW 19 36,935,901 (GRCm39) missense probably benign
R8866:Btaf1 UTSW 19 36,935,901 (GRCm39) missense probably benign
R9016:Btaf1 UTSW 19 36,971,705 (GRCm39) missense probably benign 0.00
R9028:Btaf1 UTSW 19 36,946,508 (GRCm39) missense probably damaging 1.00
R9109:Btaf1 UTSW 19 36,964,114 (GRCm39) missense probably benign
R9172:Btaf1 UTSW 19 36,977,630 (GRCm39) missense probably damaging 0.98
R9298:Btaf1 UTSW 19 36,964,114 (GRCm39) missense probably benign
R9717:Btaf1 UTSW 19 36,922,646 (GRCm39) missense probably benign 0.28
W0251:Btaf1 UTSW 19 36,980,904 (GRCm39) missense probably damaging 1.00
X0027:Btaf1 UTSW 19 36,926,496 (GRCm39) nonsense probably null
Z1088:Btaf1 UTSW 19 36,964,018 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCAGTGGCAATGTAACATTTGG -3'
(R):5'- GAGCTGCAGAATACATTCCAC -3'

Sequencing Primer
(F):5'- GCAATGTAACATTTGGTTGTCTGAAG -3'
(R):5'- AATATGCTTCTGTAGTGGCACATG -3'
Posted On 2017-07-14