Incidental Mutation 'R6083:Dnaja1'
ID482286
Institutional Source Beutler Lab
Gene Symbol Dnaja1
Ensembl Gene ENSMUSG00000028410
Gene NameDnaJ heat shock protein family (Hsp40) member A1
SynonymsHsj2, Nedd7
MMRRC Submission 044242-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.691) question?
Stock #R6083 (G1)
Quality Score215.009
Status Validated
Chromosome4
Chromosomal Location40722150-40737149 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 40731713 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 263 (D263G)
Ref Sequence ENSEMBL: ENSMUSP00000118294 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030117] [ENSMUST00000030118] [ENSMUST00000125442] [ENSMUST00000137246] [ENSMUST00000164233]
Predicted Effect probably benign
Transcript: ENSMUST00000030117
SMART Domains Protein: ENSMUSP00000030117
Gene: ENSMUSG00000028409

DomainStartEndE-ValueType
LisH 6 38 9.95e-7 SMART
CTLH 40 92 2.32e-7 SMART
WD40 202 242 9.02e-7 SMART
WD40 253 292 3.81e-5 SMART
WD40 295 335 5.26e-8 SMART
WD40 338 377 4.4e-10 SMART
WD40 380 426 1.03e1 SMART
WD40 428 470 2.97e0 SMART
WD40 473 512 9.52e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000030118
AA Change: D263G

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000030118
Gene: ENSMUSG00000028410
AA Change: D263G

DomainStartEndE-ValueType
DnaJ 5 60 4.2e-30 SMART
low complexity region 66 82 N/A INTRINSIC
low complexity region 93 104 N/A INTRINSIC
Pfam:DnaJ_CXXCXGXG 134 200 5.7e-16 PFAM
Pfam:CTDII 257 340 1.5e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125442
SMART Domains Protein: ENSMUSP00000116601
Gene: ENSMUSG00000028410

DomainStartEndE-ValueType
DnaJ 5 60 4.2e-30 SMART
low complexity region 66 82 N/A INTRINSIC
low complexity region 93 104 N/A INTRINSIC
Pfam:DnaJ_CXXCXGXG 134 200 1.8e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129204
Predicted Effect probably benign
Transcript: ENSMUST00000137246
AA Change: D263G

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000118294
Gene: ENSMUSG00000028410
AA Change: D263G

DomainStartEndE-ValueType
DnaJ 5 60 4.2e-30 SMART
low complexity region 66 82 N/A INTRINSIC
low complexity region 93 104 N/A INTRINSIC
Pfam:DnaJ_CXXCXGXG 134 200 3.2e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137476
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148976
Predicted Effect probably benign
Transcript: ENSMUST00000164233
AA Change: D263G

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000129730
Gene: ENSMUSG00000028410
AA Change: D263G

DomainStartEndE-ValueType
DnaJ 5 60 4.2e-30 SMART
low complexity region 66 82 N/A INTRINSIC
low complexity region 93 104 N/A INTRINSIC
Pfam:DnaJ_C 107 329 5.1e-35 PFAM
Pfam:DnaJ_CXXCXGXG 134 200 6e-17 PFAM
Meta Mutation Damage Score 0.0945 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 96% (76/79)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the DnaJ family, whose members act as cochaperones of heat shock protein 70. Heat shock proteins facilitate protein folding, trafficking, prevention of aggregation, and proteolytic degradation. Members of this family are characterized by a highly conserved N-terminal J domain, a glycine/phenylalanine-rich region, four CxxCxGxG zinc finger repeats, and a C-terminal substrate-binding domain. The J domain mediates the interaction with heat shock protein 70 to recruit substrates and regulate ATP hydrolysis activity. Mice deficient for this gene display reduced levels of activation‐induced deaminase, an enzyme that deaminates deoxycytidine at the immunoglobulin genes during immune responses. In addition, mice lacking this gene exhibit severe defects in spermatogenesis. Several pseudogenes of this gene are found on other chromosomes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Male mice homozygous for a knock-out allele exhibit decreased postnatal growth and reduced fertility with severe defects in late stages of spermatogenesis that involve aberrant androgen receptor signaling in Sertoli cells and disruption of Sertoli-germ cell adherens junctions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik C A 11: 58,878,851 P73Q possibly damaging Het
Aak1 A T 6: 86,963,996 I591F unknown Het
Ace C A 11: 105,985,267 Y816* probably null Het
Ahnak2 A G 12: 112,782,612 V1205A probably benign Het
Ahnak2 T G 12: 112,782,999 Q1076P probably benign Het
Ap2a1 G A 7: 44,907,751 R263W probably damaging Het
Arhgap29 A G 3: 121,992,748 T257A probably benign Het
Bora A T 14: 99,062,294 Q234L possibly damaging Het
Ccdc17 A T 4: 116,596,926 Q47L possibly damaging Het
Cep170 C T 1: 176,774,625 R305H probably damaging Het
Cyb5r4 C T 9: 87,057,168 P335S probably damaging Het
Cyp2c54 A G 19: 40,073,762 L17P probably benign Het
Cyp2c69 A T 19: 39,849,456 V394E probably damaging Het
Dedd2 G A 7: 25,211,290 P154S probably benign Het
Defb36 A T 2: 152,604,488 M1L unknown Het
Dock10 T C 1: 80,532,431 N1560S probably damaging Het
Efnb2 T C 8: 8,622,328 probably null Het
Eif3e A G 15: 43,266,144 I196T probably damaging Het
Ercc4 T A 16: 13,110,039 C24* probably null Het
Fmn1 A G 2: 113,364,303 E116G unknown Het
Gnas A G 2: 174,297,862 M1V probably null Het
Grin2a C A 16: 9,579,540 M894I probably benign Het
Herc2 G T 7: 56,228,505 S4566I probably benign Het
Hmcn1 G A 1: 150,755,293 P918L probably damaging Het
Hmcn1 G T 1: 150,755,294 P918T probably damaging Het
Hsd3b2 T A 3: 98,712,056 Y191F possibly damaging Het
Ifit1bl2 A C 19: 34,619,817 F133C possibly damaging Het
Itih2 T C 2: 10,108,894 probably benign Het
Itsn1 T C 16: 91,853,011 L191P probably benign Het
Kdr T C 5: 75,944,366 K1068R probably damaging Het
Lmtk2 T C 5: 144,182,756 L1345P probably damaging Het
Man2b2 T A 5: 36,809,041 D936V probably damaging Het
Mapk1ip1 G A 7: 138,836,588 R38* probably null Het
Med13l T C 5: 118,721,486 V246A possibly damaging Het
Mlec T A 5: 115,148,049 T248S probably benign Het
Mslnl T A 17: 25,737,902 V54D possibly damaging Het
Muc16 G A 9: 18,657,212 T1337I unknown Het
Nek7 C T 1: 138,515,654 S187N probably damaging Het
Neto2 A G 8: 85,640,585 V538A probably benign Het
Nktr T C 9: 121,750,136 probably benign Het
Npy6r A G 18: 44,276,492 K327E probably damaging Het
Olfr1230 T A 2: 89,297,024 D82V probably damaging Het
Olfr1245 T C 2: 89,575,672 D18G probably benign Het
Olfr1463 A T 19: 13,234,525 I92F probably benign Het
Olfr402 A G 11: 74,155,570 M139V possibly damaging Het
Olfr705 A G 7: 106,873,582 I221T probably damaging Het
Pcdhga4 A T 18: 37,687,425 N676Y probably damaging Het
Pde2a T C 7: 101,502,879 I331T possibly damaging Het
Pip5k1b A T 19: 24,304,035 Y486* probably null Het
Plch2 A G 4: 155,000,818 M272T probably benign Het
Rbm12 G A 2: 156,097,726 probably benign Het
Rgs19 T C 2: 181,689,507 E111G probably damaging Het
Rhbdf1 T C 11: 32,210,066 N145S probably damaging Het
Rnf4 T A 5: 34,351,221 probably null Het
Rpa1 T C 11: 75,314,911 T207A probably damaging Het
Rufy4 A C 1: 74,129,397 Q113P probably damaging Het
Sh3pxd2b T G 11: 32,422,985 S717R probably benign Het
Sin3a A T 9: 57,107,540 I682F probably damaging Het
Sipa1l2 A T 8: 125,468,473 V842E possibly damaging Het
Slc5a4a A G 10: 76,147,597 I23V unknown Het
Slitrk5 A G 14: 111,681,725 N927S probably benign Het
Smc6 A G 12: 11,276,353 K117R possibly damaging Het
Sod2 G A 17: 13,008,031 probably benign Het
Stxbp1 A G 2: 32,796,018 I567T possibly damaging Het
Tbkbp1 C A 11: 97,147,380 L209F probably damaging Het
Tll1 G T 8: 64,038,586 probably null Het
Tmem38b T C 4: 53,840,765 L60S probably damaging Het
Trib1 G A 15: 59,654,475 R298H probably damaging Het
Trim30b A G 7: 104,366,142 V13A probably damaging Het
Trip11 G A 12: 101,889,742 T425I probably benign Het
Ttn C A 2: 76,889,973 probably benign Het
Tymp GC GCC 15: 89,374,364 probably null Het
Ush2a T A 1: 188,267,023 S177T probably damaging Het
Usp40 A T 1: 87,978,559 S651R probably benign Het
Vmn1r125 T C 7: 21,272,719 S181P probably damaging Het
Vmn1r198 T A 13: 22,354,758 V138D possibly damaging Het
Vmn1r56 A G 7: 5,196,318 L100P probably damaging Het
Vmn2r32 T A 7: 7,464,210 D773V probably benign Het
Vmn2r53 A C 7: 12,581,881 H670Q probably benign Het
Vmn2r69 A T 7: 85,406,503 I809N probably damaging Het
Wdr7 G A 18: 63,728,469 G184D probably damaging Het
Wnk1 C T 6: 120,037,601 G11D probably damaging Het
Zfp110 A C 7: 12,844,675 E171A possibly damaging Het
Zkscan6 T C 11: 65,815,931 V134A probably damaging Het
Other mutations in Dnaja1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01120:Dnaja1 APN 4 40730248 missense probably damaging 1.00
R0520:Dnaja1 UTSW 4 40728072 missense probably benign
R2186:Dnaja1 UTSW 4 40732853 missense probably benign 0.04
R2917:Dnaja1 UTSW 4 40724052 missense possibly damaging 0.67
R2918:Dnaja1 UTSW 4 40724052 missense possibly damaging 0.67
R5464:Dnaja1 UTSW 4 40724133 missense probably benign 0.19
R7424:Dnaja1 UTSW 4 40730244 missense probably benign 0.20
R7664:Dnaja1 UTSW 4 40724090 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CATGTGTGTCCAGCTGTGTC -3'
(R):5'- ATGGAAGGAAAGCAAGACATTTCCC -3'

Posted On2017-07-14