Incidental Mutation 'R6083:Kdr'
ID482291
Institutional Source Beutler Lab
Gene Symbol Kdr
Ensembl Gene ENSMUSG00000062960
Gene Namekinase insert domain protein receptor
SynonymsFlk1, vascular endothelial growth factor receptor- 2, VEGF receptor-2, VEGFR2, VEGFR-2, Flk-1
MMRRC Submission 044242-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6083 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location75932827-75978458 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 75944366 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 1068 (K1068R)
Ref Sequence ENSEMBL: ENSMUSP00000109144 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113516]
Predicted Effect probably damaging
Transcript: ENSMUST00000113516
AA Change: K1068R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109144
Gene: ENSMUSG00000062960
AA Change: K1068R

DomainStartEndE-ValueType
IG 38 121 2.43e-2 SMART
IG_like 137 220 5.91e1 SMART
IG 233 327 2.64e-12 SMART
IG 339 420 1.2e-6 SMART
IG 432 546 2.14e0 SMART
IG 554 657 2.79e-2 SMART
IGc2 677 742 8.42e-20 SMART
TyrKc 832 1158 7.07e-138 SMART
low complexity region 1310 1315 N/A INTRINSIC
Meta Mutation Damage Score 0.3244 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 96% (76/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Vascular endothelial growth factor (VEGF) is a major growth factor for endothelial cells. This gene encodes one of the two receptors of the VEGF. This receptor, known as kinase insert domain receptor, is a type III receptor tyrosine kinase. It functions as the main mediator of VEGF-induced endothelial proliferation, survival, migration, tubular morphogenesis and sprouting. The signalling and trafficking of this receptor are regulated by multiple factors, including Rab GTPase, P2Y purine nucleotide receptor, integrin alphaVbeta3, T-cell protein tyrosine phosphatase, etc.. Mutations of this gene are implicated in infantile capillary hemangiomas. [provided by RefSeq, May 2009]
PHENOTYPE: Homozygous mice die at early embryonic stages due to failure of blood vessel formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik C A 11: 58,878,851 P73Q possibly damaging Het
Aak1 A T 6: 86,963,996 I591F unknown Het
Ace C A 11: 105,985,267 Y816* probably null Het
Ahnak2 A G 12: 112,782,612 V1205A probably benign Het
Ahnak2 T G 12: 112,782,999 Q1076P probably benign Het
Ap2a1 G A 7: 44,907,751 R263W probably damaging Het
Arhgap29 A G 3: 121,992,748 T257A probably benign Het
Bora A T 14: 99,062,294 Q234L possibly damaging Het
Ccdc17 A T 4: 116,596,926 Q47L possibly damaging Het
Cep170 C T 1: 176,774,625 R305H probably damaging Het
Cyb5r4 C T 9: 87,057,168 P335S probably damaging Het
Cyp2c54 A G 19: 40,073,762 L17P probably benign Het
Cyp2c69 A T 19: 39,849,456 V394E probably damaging Het
Dedd2 G A 7: 25,211,290 P154S probably benign Het
Defb36 A T 2: 152,604,488 M1L unknown Het
Dnaja1 A G 4: 40,731,713 D263G probably benign Het
Dock10 T C 1: 80,532,431 N1560S probably damaging Het
Efnb2 T C 8: 8,622,328 probably null Het
Eif3e A G 15: 43,266,144 I196T probably damaging Het
Ercc4 T A 16: 13,110,039 C24* probably null Het
Fmn1 A G 2: 113,364,303 E116G unknown Het
Gnas A G 2: 174,297,862 M1V probably null Het
Grin2a C A 16: 9,579,540 M894I probably benign Het
Herc2 G T 7: 56,228,505 S4566I probably benign Het
Hmcn1 G A 1: 150,755,293 P918L probably damaging Het
Hmcn1 G T 1: 150,755,294 P918T probably damaging Het
Hsd3b2 T A 3: 98,712,056 Y191F possibly damaging Het
Ifit1bl2 A C 19: 34,619,817 F133C possibly damaging Het
Itih2 T C 2: 10,108,894 probably benign Het
Itsn1 T C 16: 91,853,011 L191P probably benign Het
Lmtk2 T C 5: 144,182,756 L1345P probably damaging Het
Man2b2 T A 5: 36,809,041 D936V probably damaging Het
Mapk1ip1 G A 7: 138,836,588 R38* probably null Het
Med13l T C 5: 118,721,486 V246A possibly damaging Het
Mlec T A 5: 115,148,049 T248S probably benign Het
Mslnl T A 17: 25,737,902 V54D possibly damaging Het
Muc16 G A 9: 18,657,212 T1337I unknown Het
Nek7 C T 1: 138,515,654 S187N probably damaging Het
Neto2 A G 8: 85,640,585 V538A probably benign Het
Nktr T C 9: 121,750,136 probably benign Het
Npy6r A G 18: 44,276,492 K327E probably damaging Het
Olfr1230 T A 2: 89,297,024 D82V probably damaging Het
Olfr1245 T C 2: 89,575,672 D18G probably benign Het
Olfr1463 A T 19: 13,234,525 I92F probably benign Het
Olfr402 A G 11: 74,155,570 M139V possibly damaging Het
Olfr705 A G 7: 106,873,582 I221T probably damaging Het
Pcdhga4 A T 18: 37,687,425 N676Y probably damaging Het
Pde2a T C 7: 101,502,879 I331T possibly damaging Het
Pip5k1b A T 19: 24,304,035 Y486* probably null Het
Plch2 A G 4: 155,000,818 M272T probably benign Het
Rbm12 G A 2: 156,097,726 probably benign Het
Rgs19 T C 2: 181,689,507 E111G probably damaging Het
Rhbdf1 T C 11: 32,210,066 N145S probably damaging Het
Rnf4 T A 5: 34,351,221 probably null Het
Rpa1 T C 11: 75,314,911 T207A probably damaging Het
Rufy4 A C 1: 74,129,397 Q113P probably damaging Het
Sh3pxd2b T G 11: 32,422,985 S717R probably benign Het
Sin3a A T 9: 57,107,540 I682F probably damaging Het
Sipa1l2 A T 8: 125,468,473 V842E possibly damaging Het
Slc5a4a A G 10: 76,147,597 I23V unknown Het
Slitrk5 A G 14: 111,681,725 N927S probably benign Het
Smc6 A G 12: 11,276,353 K117R possibly damaging Het
Sod2 G A 17: 13,008,031 probably benign Het
Stxbp1 A G 2: 32,796,018 I567T possibly damaging Het
Tbkbp1 C A 11: 97,147,380 L209F probably damaging Het
Tll1 G T 8: 64,038,586 probably null Het
Tmem38b T C 4: 53,840,765 L60S probably damaging Het
Trib1 G A 15: 59,654,475 R298H probably damaging Het
Trim30b A G 7: 104,366,142 V13A probably damaging Het
Trip11 G A 12: 101,889,742 T425I probably benign Het
Ttn C A 2: 76,889,973 probably benign Het
Tymp GC GCC 15: 89,374,364 probably null Het
Ush2a T A 1: 188,267,023 S177T probably damaging Het
Usp40 A T 1: 87,978,559 S651R probably benign Het
Vmn1r125 T C 7: 21,272,719 S181P probably damaging Het
Vmn1r198 T A 13: 22,354,758 V138D possibly damaging Het
Vmn1r56 A G 7: 5,196,318 L100P probably damaging Het
Vmn2r32 T A 7: 7,464,210 D773V probably benign Het
Vmn2r53 A C 7: 12,581,881 H670Q probably benign Het
Vmn2r69 A T 7: 85,406,503 I809N probably damaging Het
Wdr7 G A 18: 63,728,469 G184D probably damaging Het
Wnk1 C T 6: 120,037,601 G11D probably damaging Het
Zfp110 A C 7: 12,844,675 E171A possibly damaging Het
Zkscan6 T C 11: 65,815,931 V134A probably damaging Het
Other mutations in Kdr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Kdr APN 5 75968750 missense probably damaging 1.00
IGL01094:Kdr APN 5 75961760 missense probably benign 0.00
IGL01310:Kdr APN 5 75949601 missense probably damaging 1.00
IGL01689:Kdr APN 5 75936840 missense probably benign 0.01
IGL01986:Kdr APN 5 75952859 missense probably benign 0.18
IGL02065:Kdr APN 5 75961853 splice site probably benign
IGL02200:Kdr APN 5 75950102 splice site probably benign
IGL02272:Kdr APN 5 75961840 missense probably benign
IGL02426:Kdr APN 5 75974466 missense probably benign 0.00
IGL02483:Kdr APN 5 75936294 critical splice donor site probably null
IGL02543:Kdr APN 5 75964947 splice site probably benign
IGL02590:Kdr APN 5 75936323 missense probably benign 0.00
IGL03204:Kdr APN 5 75972382 missense possibly damaging 0.96
IGL03228:Kdr APN 5 75957048 missense probably damaging 0.97
IGL03265:Kdr APN 5 75960773 missense probably damaging 1.00
engelein UTSW 5 75952889 missense probably damaging 1.00
PIT4131001:Kdr UTSW 5 75941971 splice site probably benign
PIT4519001:Kdr UTSW 5 75936896 missense possibly damaging 0.86
R0133:Kdr UTSW 5 75951838 missense probably damaging 1.00
R0197:Kdr UTSW 5 75968422 missense possibly damaging 0.82
R0282:Kdr UTSW 5 75950100 splice site probably benign
R0309:Kdr UTSW 5 75946927 splice site probably benign
R0371:Kdr UTSW 5 75941834 missense probably benign 0.22
R0396:Kdr UTSW 5 75960728 missense possibly damaging 0.65
R0498:Kdr UTSW 5 75959138 missense probably benign 0.00
R0932:Kdr UTSW 5 75968805 missense probably benign 0.02
R1077:Kdr UTSW 5 75956231 missense probably damaging 1.00
R1183:Kdr UTSW 5 75946851 missense probably damaging 1.00
R1713:Kdr UTSW 5 75968467 missense probably benign 0.03
R1853:Kdr UTSW 5 75952905 missense possibly damaging 0.67
R1854:Kdr UTSW 5 75952905 missense possibly damaging 0.67
R2142:Kdr UTSW 5 75968423 missense possibly damaging 0.56
R2238:Kdr UTSW 5 75949519 missense possibly damaging 0.78
R2891:Kdr UTSW 5 75946836 missense probably damaging 1.00
R2893:Kdr UTSW 5 75946836 missense probably damaging 1.00
R2894:Kdr UTSW 5 75946836 missense probably damaging 1.00
R2903:Kdr UTSW 5 75966409 missense probably damaging 1.00
R2904:Kdr UTSW 5 75966409 missense probably damaging 1.00
R3155:Kdr UTSW 5 75968405 missense probably benign 0.02
R3939:Kdr UTSW 5 75972429 nonsense probably null
R4051:Kdr UTSW 5 75968408 missense probably benign
R4151:Kdr UTSW 5 75957101 missense possibly damaging 0.94
R4433:Kdr UTSW 5 75943925 missense possibly damaging 0.61
R4687:Kdr UTSW 5 75968792 missense possibly damaging 0.81
R4691:Kdr UTSW 5 75944599 missense possibly damaging 0.79
R5185:Kdr UTSW 5 75952417 splice site probably null
R5544:Kdr UTSW 5 75960743 nonsense probably null
R6477:Kdr UTSW 5 75968841 missense probably benign 0.02
R6568:Kdr UTSW 5 75961774 missense probably benign 0.01
R6647:Kdr UTSW 5 75952889 missense probably damaging 1.00
R6827:Kdr UTSW 5 75944545 missense probably damaging 1.00
R6887:Kdr UTSW 5 75968451 missense probably benign 0.00
R6929:Kdr UTSW 5 75978104 missense probably benign 0.16
R6993:Kdr UTSW 5 75972411 missense probably benign
R7022:Kdr UTSW 5 75972260 nonsense probably null
R7050:Kdr UTSW 5 75950120 missense probably damaging 1.00
R7099:Kdr UTSW 5 75944333 missense probably damaging 0.98
R7274:Kdr UTSW 5 75964700 missense probably benign 0.00
R7310:Kdr UTSW 5 75944325 missense probably damaging 0.99
R7565:Kdr UTSW 5 75948843 missense probably damaging 0.97
X0024:Kdr UTSW 5 75974406 missense probably damaging 1.00
Z1177:Kdr UTSW 5 75968475 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- ACACACAAGGCTCAATGGTC -3'
(R):5'- TAAGATCTGTGACTTCGGCTTG -3'

Posted On2017-07-14