Incidental Mutation 'R6083:Vmn2r69'
ID 482305
Institutional Source Beutler Lab
Gene Symbol Vmn2r69
Ensembl Gene ENSMUSG00000091006
Gene Name vomeronasal 2, receptor 69
Synonyms
MMRRC Submission 044242-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.074) question?
Stock # R6083 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 85055584-85064884 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 85055711 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 809 (I809N)
Ref Sequence ENSEMBL: ENSMUSP00000132726 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171213]
AlphaFold G3XA45
Predicted Effect probably damaging
Transcript: ENSMUST00000171213
AA Change: I809N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132726
Gene: ENSMUSG00000091006
AA Change: I809N

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 77 465 1.3e-28 PFAM
Pfam:NCD3G 507 559 1.8e-20 PFAM
Pfam:7tm_3 592 827 3.2e-54 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207880
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 96% (76/79)
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik C A 11: 58,769,677 (GRCm39) P73Q possibly damaging Het
Aak1 A T 6: 86,940,978 (GRCm39) I591F unknown Het
Ace C A 11: 105,876,093 (GRCm39) Y816* probably null Het
Ahnak2 A G 12: 112,746,715 (GRCm39) V1205A probably benign Het
Ahnak2 T G 12: 112,746,589 (GRCm39) Q1076P probably benign Het
Ap2a1 G A 7: 44,557,175 (GRCm39) R263W probably damaging Het
Arhgap29 A G 3: 121,786,397 (GRCm39) T257A probably benign Het
Bora A T 14: 99,299,730 (GRCm39) Q234L possibly damaging Het
Ccdc17 A T 4: 116,454,123 (GRCm39) Q47L possibly damaging Het
Cep170 C T 1: 176,602,191 (GRCm39) R305H probably damaging Het
Cyb5r4 C T 9: 86,939,221 (GRCm39) P335S probably damaging Het
Cyp2c54 A G 19: 40,062,206 (GRCm39) L17P probably benign Het
Cyp2c69 A T 19: 39,837,900 (GRCm39) V394E probably damaging Het
Dedd2 G A 7: 24,910,715 (GRCm39) P154S probably benign Het
Defb36 A T 2: 152,446,408 (GRCm39) M1L unknown Het
Dnaja1 A G 4: 40,731,713 (GRCm39) D263G probably benign Het
Dock10 T C 1: 80,510,148 (GRCm39) N1560S probably damaging Het
Efnb2 T C 8: 8,672,328 (GRCm39) probably null Het
Eif3e A G 15: 43,129,540 (GRCm39) I196T probably damaging Het
Ercc4 T A 16: 12,927,903 (GRCm39) C24* probably null Het
Fmn1 A G 2: 113,194,648 (GRCm39) E116G unknown Het
Gnas A G 2: 174,139,655 (GRCm39) M1V probably null Het
Grin2a C A 16: 9,397,404 (GRCm39) M894I probably benign Het
Herc2 G T 7: 55,878,253 (GRCm39) S4566I probably benign Het
Hmcn1 G A 1: 150,631,044 (GRCm39) P918L probably damaging Het
Hmcn1 G T 1: 150,631,045 (GRCm39) P918T probably damaging Het
Hsd3b2 T A 3: 98,619,372 (GRCm39) Y191F possibly damaging Het
Ifit1bl2 A C 19: 34,597,217 (GRCm39) F133C possibly damaging Het
Itih2 T C 2: 10,113,705 (GRCm39) probably benign Het
Itsn1 T C 16: 91,649,899 (GRCm39) L191P probably benign Het
Kdr T C 5: 76,105,026 (GRCm39) K1068R probably damaging Het
Lmtk2 T C 5: 144,119,574 (GRCm39) L1345P probably damaging Het
Man2b2 T A 5: 36,966,385 (GRCm39) D936V probably damaging Het
Mapk1ip1 G A 7: 138,438,317 (GRCm39) R38* probably null Het
Med13l T C 5: 118,859,551 (GRCm39) V246A possibly damaging Het
Mlec T A 5: 115,286,108 (GRCm39) T248S probably benign Het
Mslnl T A 17: 25,956,876 (GRCm39) V54D possibly damaging Het
Muc16 G A 9: 18,568,508 (GRCm39) T1337I unknown Het
Nek7 C T 1: 138,443,392 (GRCm39) S187N probably damaging Het
Neto2 A G 8: 86,367,214 (GRCm39) V538A probably benign Het
Nktr T C 9: 121,579,202 (GRCm39) probably benign Het
Npy6r A G 18: 44,409,559 (GRCm39) K327E probably damaging Het
Or2ag1 A G 7: 106,472,789 (GRCm39) I221T probably damaging Het
Or3a1c A G 11: 74,046,396 (GRCm39) M139V possibly damaging Het
Or4a72 T C 2: 89,406,016 (GRCm39) D18G probably benign Het
Or4c123 T A 2: 89,127,368 (GRCm39) D82V probably damaging Het
Or5b109 A T 19: 13,211,889 (GRCm39) I92F probably benign Het
Pcdhga4 A T 18: 37,820,478 (GRCm39) N676Y probably damaging Het
Pde2a T C 7: 101,152,086 (GRCm39) I331T possibly damaging Het
Pip5k1b A T 19: 24,281,399 (GRCm39) Y486* probably null Het
Plch2 A G 4: 155,085,275 (GRCm39) M272T probably benign Het
Rbm12 G A 2: 155,939,646 (GRCm39) probably benign Het
Rgs19 T C 2: 181,331,300 (GRCm39) E111G probably damaging Het
Rhbdf1 T C 11: 32,160,066 (GRCm39) N145S probably damaging Het
Rnf4 T A 5: 34,508,565 (GRCm39) probably null Het
Rpa1 T C 11: 75,205,737 (GRCm39) T207A probably damaging Het
Rufy4 A C 1: 74,168,556 (GRCm39) Q113P probably damaging Het
Sh3pxd2b T G 11: 32,372,985 (GRCm39) S717R probably benign Het
Sin3a A T 9: 57,014,824 (GRCm39) I682F probably damaging Het
Sipa1l2 A T 8: 126,195,212 (GRCm39) V842E possibly damaging Het
Slc5a4a A G 10: 75,983,431 (GRCm39) I23V unknown Het
Slitrk5 A G 14: 111,919,157 (GRCm39) N927S probably benign Het
Smc6 A G 12: 11,326,354 (GRCm39) K117R possibly damaging Het
Sod2 G A 17: 13,226,918 (GRCm39) probably benign Het
Stxbp1 A G 2: 32,686,030 (GRCm39) I567T possibly damaging Het
Tbkbp1 C A 11: 97,038,206 (GRCm39) L209F probably damaging Het
Tll1 G T 8: 64,491,620 (GRCm39) probably null Het
Tmem38b T C 4: 53,840,765 (GRCm39) L60S probably damaging Het
Trib1 G A 15: 59,526,324 (GRCm39) R298H probably damaging Het
Trim30b A G 7: 104,015,349 (GRCm39) V13A probably damaging Het
Trip11 G A 12: 101,856,001 (GRCm39) T425I probably benign Het
Ttn C A 2: 76,720,317 (GRCm39) probably benign Het
Tymp GC GCC 15: 89,258,567 (GRCm39) probably null Het
Ush2a T A 1: 187,999,220 (GRCm39) S177T probably damaging Het
Usp40 A T 1: 87,906,281 (GRCm39) S651R probably benign Het
Vmn1r125 T C 7: 21,006,644 (GRCm39) S181P probably damaging Het
Vmn1r198 T A 13: 22,538,928 (GRCm39) V138D possibly damaging Het
Vmn1r56 A G 7: 5,199,317 (GRCm39) L100P probably damaging Het
Vmn2r32 T A 7: 7,467,209 (GRCm39) D773V probably benign Het
Vmn2r53 A C 7: 12,315,808 (GRCm39) H670Q probably benign Het
Wdr7 G A 18: 63,861,540 (GRCm39) G184D probably damaging Het
Wnk1 C T 6: 120,014,562 (GRCm39) G11D probably damaging Het
Zfp110 A C 7: 12,578,602 (GRCm39) E171A possibly damaging Het
Zkscan6 T C 11: 65,706,757 (GRCm39) V134A probably damaging Het
Other mutations in Vmn2r69
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01019:Vmn2r69 APN 7 85,055,739 (GRCm39) missense probably benign
IGL01457:Vmn2r69 APN 7 85,055,836 (GRCm39) missense possibly damaging 0.87
IGL01760:Vmn2r69 APN 7 85,056,072 (GRCm39) missense possibly damaging 0.90
IGL01834:Vmn2r69 APN 7 85,061,576 (GRCm39) missense probably damaging 1.00
IGL02001:Vmn2r69 APN 7 85,056,434 (GRCm39) missense probably benign 0.05
IGL02057:Vmn2r69 APN 7 85,060,990 (GRCm39) missense possibly damaging 0.93
IGL02289:Vmn2r69 APN 7 85,056,054 (GRCm39) missense probably damaging 1.00
IGL02472:Vmn2r69 APN 7 85,058,960 (GRCm39) missense probably benign 0.01
IGL02478:Vmn2r69 APN 7 85,055,889 (GRCm39) missense probably damaging 1.00
IGL02554:Vmn2r69 APN 7 85,059,014 (GRCm39) missense probably damaging 1.00
IGL02723:Vmn2r69 APN 7 85,059,416 (GRCm39) missense probably damaging 1.00
R0526:Vmn2r69 UTSW 7 85,060,711 (GRCm39) missense probably damaging 1.00
R0560:Vmn2r69 UTSW 7 85,058,922 (GRCm39) critical splice donor site probably null
R0909:Vmn2r69 UTSW 7 85,055,873 (GRCm39) missense probably benign 0.00
R0976:Vmn2r69 UTSW 7 85,056,108 (GRCm39) missense probably damaging 1.00
R1158:Vmn2r69 UTSW 7 85,059,058 (GRCm39) splice site probably benign
R1459:Vmn2r69 UTSW 7 85,055,908 (GRCm39) nonsense probably null
R1482:Vmn2r69 UTSW 7 85,056,082 (GRCm39) missense probably damaging 1.00
R1917:Vmn2r69 UTSW 7 85,060,891 (GRCm39) missense probably damaging 1.00
R2016:Vmn2r69 UTSW 7 85,056,493 (GRCm39) missense probably damaging 0.98
R2108:Vmn2r69 UTSW 7 85,059,404 (GRCm39) missense probably benign
R2571:Vmn2r69 UTSW 7 85,064,764 (GRCm39) missense probably benign
R2910:Vmn2r69 UTSW 7 85,055,918 (GRCm39) missense probably damaging 1.00
R2920:Vmn2r69 UTSW 7 85,060,973 (GRCm39) missense probably benign 0.08
R3708:Vmn2r69 UTSW 7 85,061,029 (GRCm39) missense probably damaging 0.98
R3710:Vmn2r69 UTSW 7 85,055,601 (GRCm39) missense probably benign
R4757:Vmn2r69 UTSW 7 85,061,575 (GRCm39) missense probably damaging 0.99
R4823:Vmn2r69 UTSW 7 85,060,508 (GRCm39) missense probably benign 0.21
R4870:Vmn2r69 UTSW 7 85,060,793 (GRCm39) missense possibly damaging 0.93
R4918:Vmn2r69 UTSW 7 85,055,967 (GRCm39) missense probably benign 0.06
R5022:Vmn2r69 UTSW 7 85,060,367 (GRCm39) missense possibly damaging 0.72
R5174:Vmn2r69 UTSW 7 85,064,739 (GRCm39) missense possibly damaging 0.92
R5200:Vmn2r69 UTSW 7 85,055,717 (GRCm39) missense probably damaging 1.00
R5278:Vmn2r69 UTSW 7 85,060,991 (GRCm39) missense probably benign 0.02
R5643:Vmn2r69 UTSW 7 85,056,404 (GRCm39) missense probably damaging 0.98
R5996:Vmn2r69 UTSW 7 85,061,117 (GRCm39) splice site probably null
R6140:Vmn2r69 UTSW 7 85,060,657 (GRCm39) missense probably damaging 0.99
R6306:Vmn2r69 UTSW 7 85,064,799 (GRCm39) missense probably benign 0.04
R6330:Vmn2r69 UTSW 7 85,060,835 (GRCm39) missense probably benign
R6380:Vmn2r69 UTSW 7 85,061,067 (GRCm39) missense probably benign
R6466:Vmn2r69 UTSW 7 85,056,378 (GRCm39) missense probably benign 0.01
R6542:Vmn2r69 UTSW 7 85,060,413 (GRCm39) nonsense probably null
R6583:Vmn2r69 UTSW 7 85,059,017 (GRCm39) missense probably benign
R6623:Vmn2r69 UTSW 7 85,056,309 (GRCm39) missense possibly damaging 0.84
R6709:Vmn2r69 UTSW 7 85,061,069 (GRCm39) missense probably benign 0.03
R6732:Vmn2r69 UTSW 7 85,060,351 (GRCm39) missense probably benign 0.00
R6741:Vmn2r69 UTSW 7 85,061,724 (GRCm39) missense probably benign 0.01
R7070:Vmn2r69 UTSW 7 85,060,688 (GRCm39) missense probably damaging 0.98
R7234:Vmn2r69 UTSW 7 85,056,315 (GRCm39) missense probably benign 0.22
R7323:Vmn2r69 UTSW 7 85,060,972 (GRCm39) missense possibly damaging 0.95
R7427:Vmn2r69 UTSW 7 85,060,467 (GRCm39) missense probably benign 0.28
R7428:Vmn2r69 UTSW 7 85,060,467 (GRCm39) missense probably benign 0.28
R7453:Vmn2r69 UTSW 7 85,060,768 (GRCm39) frame shift probably null
R7532:Vmn2r69 UTSW 7 85,059,622 (GRCm39) missense probably benign 0.36
R7556:Vmn2r69 UTSW 7 85,060,768 (GRCm39) frame shift probably null
R7562:Vmn2r69 UTSW 7 85,056,420 (GRCm39) missense probably benign
R7592:Vmn2r69 UTSW 7 85,060,768 (GRCm39) frame shift probably null
R7708:Vmn2r69 UTSW 7 85,061,755 (GRCm39) missense possibly damaging 0.87
R7803:Vmn2r69 UTSW 7 85,056,324 (GRCm39) missense probably benign 0.00
R7960:Vmn2r69 UTSW 7 85,055,973 (GRCm39) missense probably benign
R7966:Vmn2r69 UTSW 7 85,060,762 (GRCm39) missense possibly damaging 0.81
R8071:Vmn2r69 UTSW 7 85,055,713 (GRCm39) nonsense probably null
R8237:Vmn2r69 UTSW 7 85,060,340 (GRCm39) missense probably benign 0.02
R8347:Vmn2r69 UTSW 7 85,064,838 (GRCm39) missense probably benign 0.00
R8737:Vmn2r69 UTSW 7 85,055,783 (GRCm39) missense probably damaging 1.00
R8795:Vmn2r69 UTSW 7 85,064,883 (GRCm39) start codon destroyed probably null 0.94
R8831:Vmn2r69 UTSW 7 85,059,018 (GRCm39) nonsense probably null
R8856:Vmn2r69 UTSW 7 85,061,663 (GRCm39) missense probably benign 0.00
R8998:Vmn2r69 UTSW 7 85,060,307 (GRCm39) missense probably benign 0.33
R8999:Vmn2r69 UTSW 7 85,060,307 (GRCm39) missense probably benign 0.33
R9161:Vmn2r69 UTSW 7 85,056,177 (GRCm39) missense possibly damaging 0.88
R9228:Vmn2r69 UTSW 7 85,064,697 (GRCm39) missense probably benign 0.01
R9494:Vmn2r69 UTSW 7 85,060,768 (GRCm39) missense probably damaging 1.00
R9494:Vmn2r69 UTSW 7 85,056,084 (GRCm39) missense probably benign 0.08
R9541:Vmn2r69 UTSW 7 85,056,209 (GRCm39) missense probably benign
R9620:Vmn2r69 UTSW 7 85,061,504 (GRCm39) missense probably benign 0.10
Z1176:Vmn2r69 UTSW 7 85,055,696 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAAGTGGCAATTTTCAGATACCTG -3'
(R):5'- CATGGGCTCTGTTGCTCTAG -3'

Posted On 2017-07-14