Incidental Mutation 'R6083:Slc5a4a'
ID 482316
Institutional Source Beutler Lab
Gene Symbol Slc5a4a
Ensembl Gene ENSMUSG00000020229
Gene Name solute carrier family 5, member 4a
Synonyms
MMRRC Submission 044242-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.076) question?
Stock # R6083 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 75983285-76025099 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 75983431 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 23 (I23V)
Ref Sequence ENSEMBL: ENSMUSP00000020450 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020450]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000020450
AA Change: I23V
SMART Domains Protein: ENSMUSP00000020450
Gene: ENSMUSG00000020229
AA Change: I23V

DomainStartEndE-ValueType
transmembrane domain 26 48 N/A INTRINSIC
Pfam:SSF 58 492 4e-161 PFAM
transmembrane domain 526 548 N/A INTRINSIC
transmembrane domain 636 655 N/A INTRINSIC
Meta Mutation Damage Score 0.0660 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 96% (76/79)
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik C A 11: 58,769,677 (GRCm39) P73Q possibly damaging Het
Aak1 A T 6: 86,940,978 (GRCm39) I591F unknown Het
Ace C A 11: 105,876,093 (GRCm39) Y816* probably null Het
Ahnak2 A G 12: 112,746,715 (GRCm39) V1205A probably benign Het
Ahnak2 T G 12: 112,746,589 (GRCm39) Q1076P probably benign Het
Ap2a1 G A 7: 44,557,175 (GRCm39) R263W probably damaging Het
Arhgap29 A G 3: 121,786,397 (GRCm39) T257A probably benign Het
Bora A T 14: 99,299,730 (GRCm39) Q234L possibly damaging Het
Ccdc17 A T 4: 116,454,123 (GRCm39) Q47L possibly damaging Het
Cep170 C T 1: 176,602,191 (GRCm39) R305H probably damaging Het
Cyb5r4 C T 9: 86,939,221 (GRCm39) P335S probably damaging Het
Cyp2c54 A G 19: 40,062,206 (GRCm39) L17P probably benign Het
Cyp2c69 A T 19: 39,837,900 (GRCm39) V394E probably damaging Het
Dedd2 G A 7: 24,910,715 (GRCm39) P154S probably benign Het
Defb36 A T 2: 152,446,408 (GRCm39) M1L unknown Het
Dnaja1 A G 4: 40,731,713 (GRCm39) D263G probably benign Het
Dock10 T C 1: 80,510,148 (GRCm39) N1560S probably damaging Het
Efnb2 T C 8: 8,672,328 (GRCm39) probably null Het
Eif3e A G 15: 43,129,540 (GRCm39) I196T probably damaging Het
Ercc4 T A 16: 12,927,903 (GRCm39) C24* probably null Het
Fmn1 A G 2: 113,194,648 (GRCm39) E116G unknown Het
Gnas A G 2: 174,139,655 (GRCm39) M1V probably null Het
Grin2a C A 16: 9,397,404 (GRCm39) M894I probably benign Het
Herc2 G T 7: 55,878,253 (GRCm39) S4566I probably benign Het
Hmcn1 G A 1: 150,631,044 (GRCm39) P918L probably damaging Het
Hmcn1 G T 1: 150,631,045 (GRCm39) P918T probably damaging Het
Hsd3b2 T A 3: 98,619,372 (GRCm39) Y191F possibly damaging Het
Ifit1bl2 A C 19: 34,597,217 (GRCm39) F133C possibly damaging Het
Itih2 T C 2: 10,113,705 (GRCm39) probably benign Het
Itsn1 T C 16: 91,649,899 (GRCm39) L191P probably benign Het
Kdr T C 5: 76,105,026 (GRCm39) K1068R probably damaging Het
Lmtk2 T C 5: 144,119,574 (GRCm39) L1345P probably damaging Het
Man2b2 T A 5: 36,966,385 (GRCm39) D936V probably damaging Het
Mapk1ip1 G A 7: 138,438,317 (GRCm39) R38* probably null Het
Med13l T C 5: 118,859,551 (GRCm39) V246A possibly damaging Het
Mlec T A 5: 115,286,108 (GRCm39) T248S probably benign Het
Mslnl T A 17: 25,956,876 (GRCm39) V54D possibly damaging Het
Muc16 G A 9: 18,568,508 (GRCm39) T1337I unknown Het
Nek7 C T 1: 138,443,392 (GRCm39) S187N probably damaging Het
Neto2 A G 8: 86,367,214 (GRCm39) V538A probably benign Het
Nktr T C 9: 121,579,202 (GRCm39) probably benign Het
Npy6r A G 18: 44,409,559 (GRCm39) K327E probably damaging Het
Or2ag1 A G 7: 106,472,789 (GRCm39) I221T probably damaging Het
Or3a1c A G 11: 74,046,396 (GRCm39) M139V possibly damaging Het
Or4a72 T C 2: 89,406,016 (GRCm39) D18G probably benign Het
Or4c123 T A 2: 89,127,368 (GRCm39) D82V probably damaging Het
Or5b109 A T 19: 13,211,889 (GRCm39) I92F probably benign Het
Pcdhga4 A T 18: 37,820,478 (GRCm39) N676Y probably damaging Het
Pde2a T C 7: 101,152,086 (GRCm39) I331T possibly damaging Het
Pip5k1b A T 19: 24,281,399 (GRCm39) Y486* probably null Het
Plch2 A G 4: 155,085,275 (GRCm39) M272T probably benign Het
Rbm12 G A 2: 155,939,646 (GRCm39) probably benign Het
Rgs19 T C 2: 181,331,300 (GRCm39) E111G probably damaging Het
Rhbdf1 T C 11: 32,160,066 (GRCm39) N145S probably damaging Het
Rnf4 T A 5: 34,508,565 (GRCm39) probably null Het
Rpa1 T C 11: 75,205,737 (GRCm39) T207A probably damaging Het
Rufy4 A C 1: 74,168,556 (GRCm39) Q113P probably damaging Het
Sh3pxd2b T G 11: 32,372,985 (GRCm39) S717R probably benign Het
Sin3a A T 9: 57,014,824 (GRCm39) I682F probably damaging Het
Sipa1l2 A T 8: 126,195,212 (GRCm39) V842E possibly damaging Het
Slitrk5 A G 14: 111,919,157 (GRCm39) N927S probably benign Het
Smc6 A G 12: 11,326,354 (GRCm39) K117R possibly damaging Het
Sod2 G A 17: 13,226,918 (GRCm39) probably benign Het
Stxbp1 A G 2: 32,686,030 (GRCm39) I567T possibly damaging Het
Tbkbp1 C A 11: 97,038,206 (GRCm39) L209F probably damaging Het
Tll1 G T 8: 64,491,620 (GRCm39) probably null Het
Tmem38b T C 4: 53,840,765 (GRCm39) L60S probably damaging Het
Trib1 G A 15: 59,526,324 (GRCm39) R298H probably damaging Het
Trim30b A G 7: 104,015,349 (GRCm39) V13A probably damaging Het
Trip11 G A 12: 101,856,001 (GRCm39) T425I probably benign Het
Ttn C A 2: 76,720,317 (GRCm39) probably benign Het
Tymp GC GCC 15: 89,258,567 (GRCm39) probably null Het
Ush2a T A 1: 187,999,220 (GRCm39) S177T probably damaging Het
Usp40 A T 1: 87,906,281 (GRCm39) S651R probably benign Het
Vmn1r125 T C 7: 21,006,644 (GRCm39) S181P probably damaging Het
Vmn1r198 T A 13: 22,538,928 (GRCm39) V138D possibly damaging Het
Vmn1r56 A G 7: 5,199,317 (GRCm39) L100P probably damaging Het
Vmn2r32 T A 7: 7,467,209 (GRCm39) D773V probably benign Het
Vmn2r53 A C 7: 12,315,808 (GRCm39) H670Q probably benign Het
Vmn2r69 A T 7: 85,055,711 (GRCm39) I809N probably damaging Het
Wdr7 G A 18: 63,861,540 (GRCm39) G184D probably damaging Het
Wnk1 C T 6: 120,014,562 (GRCm39) G11D probably damaging Het
Zfp110 A C 7: 12,578,602 (GRCm39) E171A possibly damaging Het
Zkscan6 T C 11: 65,706,757 (GRCm39) V134A probably damaging Het
Other mutations in Slc5a4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00670:Slc5a4a APN 10 75,999,567 (GRCm39) missense probably damaging 1.00
IGL01725:Slc5a4a APN 10 76,017,508 (GRCm39) missense probably benign 0.00
IGL02629:Slc5a4a APN 10 75,983,413 (GRCm39) missense unknown
IGL02976:Slc5a4a APN 10 76,006,527 (GRCm39) missense possibly damaging 0.67
IGL03255:Slc5a4a APN 10 75,986,346 (GRCm39) missense probably damaging 1.00
IGL03258:Slc5a4a APN 10 75,986,386 (GRCm39) missense possibly damaging 0.81
R0054:Slc5a4a UTSW 10 76,014,031 (GRCm39) missense probably null 0.00
R0244:Slc5a4a UTSW 10 76,024,986 (GRCm39) missense possibly damaging 0.46
R0398:Slc5a4a UTSW 10 76,018,556 (GRCm39) missense possibly damaging 0.46
R0799:Slc5a4a UTSW 10 76,012,368 (GRCm39) missense probably benign 0.00
R1160:Slc5a4a UTSW 10 76,013,995 (GRCm39) missense possibly damaging 0.52
R1471:Slc5a4a UTSW 10 76,022,362 (GRCm39) missense probably damaging 0.99
R1720:Slc5a4a UTSW 10 76,025,103 (GRCm39) splice site probably null
R1857:Slc5a4a UTSW 10 76,002,569 (GRCm39) missense probably benign 0.27
R1858:Slc5a4a UTSW 10 76,002,569 (GRCm39) missense probably benign 0.27
R1859:Slc5a4a UTSW 10 76,002,569 (GRCm39) missense probably benign 0.27
R1942:Slc5a4a UTSW 10 75,983,422 (GRCm39) missense unknown
R2016:Slc5a4a UTSW 10 75,989,414 (GRCm39) missense probably benign 0.00
R2316:Slc5a4a UTSW 10 76,013,915 (GRCm39) splice site probably null
R3420:Slc5a4a UTSW 10 76,012,407 (GRCm39) missense probably benign 0.00
R3421:Slc5a4a UTSW 10 76,012,407 (GRCm39) missense probably benign 0.00
R3422:Slc5a4a UTSW 10 76,012,407 (GRCm39) missense probably benign 0.00
R3845:Slc5a4a UTSW 10 76,024,983 (GRCm39) missense probably damaging 0.99
R3874:Slc5a4a UTSW 10 76,017,489 (GRCm39) missense probably benign 0.42
R4523:Slc5a4a UTSW 10 75,984,196 (GRCm39) missense probably damaging 0.99
R4537:Slc5a4a UTSW 10 76,013,929 (GRCm39) nonsense probably null
R4538:Slc5a4a UTSW 10 76,013,929 (GRCm39) nonsense probably null
R4755:Slc5a4a UTSW 10 76,022,398 (GRCm39) missense probably benign 0.00
R4868:Slc5a4a UTSW 10 76,014,065 (GRCm39) missense probably damaging 0.98
R5135:Slc5a4a UTSW 10 75,983,428 (GRCm39) missense unknown
R5254:Slc5a4a UTSW 10 76,018,572 (GRCm39) nonsense probably null
R6331:Slc5a4a UTSW 10 76,014,034 (GRCm39) missense probably damaging 0.98
R7591:Slc5a4a UTSW 10 75,983,501 (GRCm39) critical splice donor site probably benign
R7671:Slc5a4a UTSW 10 75,983,384 (GRCm39) missense unknown
R8785:Slc5a4a UTSW 10 75,986,238 (GRCm39) critical splice acceptor site probably benign
R8929:Slc5a4a UTSW 10 76,006,617 (GRCm39) missense probably benign 0.27
R8993:Slc5a4a UTSW 10 76,022,369 (GRCm39) missense probably benign 0.15
R9018:Slc5a4a UTSW 10 76,002,546 (GRCm39) missense possibly damaging 0.67
R9474:Slc5a4a UTSW 10 75,986,238 (GRCm39) critical splice acceptor site probably benign
R9567:Slc5a4a UTSW 10 76,022,396 (GRCm39) missense probably benign 0.08
R9648:Slc5a4a UTSW 10 76,002,608 (GRCm39) missense probably damaging 1.00
Z1177:Slc5a4a UTSW 10 76,018,681 (GRCm39) nonsense probably null
Z1177:Slc5a4a UTSW 10 76,002,578 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTTAAAGGTCTCCAGTGCGTAG -3'
(R):5'- GGCAACTTTTCCAGGCAGAAAG -3'

Posted On 2017-07-14