Incidental Mutation 'R6083:Rhbdf1'
ID482317
Institutional Source Beutler Lab
Gene Symbol Rhbdf1
Ensembl Gene ENSMUSG00000020282
Gene Namerhomboid 5 homolog 1
SynonymsDist, Dist1, Egfr-rs
MMRRC Submission 044242-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.164) question?
Stock #R6083 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location32209585-32222300 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32210066 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 145 (N145S)
Ref Sequence ENSEMBL: ENSMUSP00000117471 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020524] [ENSMUST00000039601] [ENSMUST00000121182] [ENSMUST00000132578] [ENSMUST00000143988] [ENSMUST00000146179] [ENSMUST00000149043]
Predicted Effect probably damaging
Transcript: ENSMUST00000020524
AA Change: N770S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020524
Gene: ENSMUSG00000020282
AA Change: N770S

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
Pfam:Rhomboid_SP 91 308 1.6e-116 PFAM
Pfam:Rhomboid 648 792 2.1e-32 PFAM
transmembrane domain 805 827 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000039601
SMART Domains Protein: ENSMUSP00000046654
Gene: ENSMUSG00000040767

DomainStartEndE-ValueType
PDB:1V2Y|A 31 123 4e-63 PDB
Blast:UBQ 32 119 1e-30 BLAST
SCOP:d1euvb_ 32 121 3e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121182
SMART Domains Protein: ENSMUSP00000112483
Gene: ENSMUSG00000040767

DomainStartEndE-ValueType
PDB:1V2Y|A 31 83 4e-28 PDB
Blast:UBQ 32 83 2e-11 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125837
Predicted Effect probably benign
Transcript: ENSMUST00000132578
SMART Domains Protein: ENSMUSP00000120543
Gene: ENSMUSG00000020282

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
Pfam:Rhomboid_SP 91 158 7.9e-35 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137125
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142274
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143036
Predicted Effect probably damaging
Transcript: ENSMUST00000143988
AA Change: N145S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117471
Gene: ENSMUSG00000020282
AA Change: N145S

DomainStartEndE-ValueType
Pfam:Rhomboid 52 167 1.6e-24 PFAM
transmembrane domain 181 203 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146179
SMART Domains Protein: ENSMUSP00000118985
Gene: ENSMUSG00000020282

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
Pfam:Rhomboid_SP 91 155 7.1e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149043
SMART Domains Protein: ENSMUSP00000119306
Gene: ENSMUSG00000040767

DomainStartEndE-ValueType
PDB:1V2Y|A 31 96 1e-40 PDB
Blast:UBQ 32 96 3e-15 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155736
Meta Mutation Damage Score 0.9533 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 96% (76/79)
MGI Phenotype PHENOTYPE: Homozygotes for a null allele show pleiotropic phenotypes and postnatal lethality largely dependent on the genetic background. Observed defects range from small size, reduced fat mass, and brain haemorrhages to small lymph organs, thrombosis, abnormal pancreatic acini, and behavioral deficits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik C A 11: 58,878,851 P73Q possibly damaging Het
Aak1 A T 6: 86,963,996 I591F unknown Het
Ace C A 11: 105,985,267 Y816* probably null Het
Ahnak2 A G 12: 112,782,612 V1205A probably benign Het
Ahnak2 T G 12: 112,782,999 Q1076P probably benign Het
Ap2a1 G A 7: 44,907,751 R263W probably damaging Het
Arhgap29 A G 3: 121,992,748 T257A probably benign Het
Bora A T 14: 99,062,294 Q234L possibly damaging Het
Ccdc17 A T 4: 116,596,926 Q47L possibly damaging Het
Cep170 C T 1: 176,774,625 R305H probably damaging Het
Cyb5r4 C T 9: 87,057,168 P335S probably damaging Het
Cyp2c54 A G 19: 40,073,762 L17P probably benign Het
Cyp2c69 A T 19: 39,849,456 V394E probably damaging Het
Dedd2 G A 7: 25,211,290 P154S probably benign Het
Defb36 A T 2: 152,604,488 M1L unknown Het
Dnaja1 A G 4: 40,731,713 D263G probably benign Het
Dock10 T C 1: 80,532,431 N1560S probably damaging Het
Efnb2 T C 8: 8,622,328 probably null Het
Eif3e A G 15: 43,266,144 I196T probably damaging Het
Ercc4 T A 16: 13,110,039 C24* probably null Het
Fmn1 A G 2: 113,364,303 E116G unknown Het
Gnas A G 2: 174,297,862 M1V probably null Het
Grin2a C A 16: 9,579,540 M894I probably benign Het
Herc2 G T 7: 56,228,505 S4566I probably benign Het
Hmcn1 G A 1: 150,755,293 P918L probably damaging Het
Hmcn1 G T 1: 150,755,294 P918T probably damaging Het
Hsd3b2 T A 3: 98,712,056 Y191F possibly damaging Het
Ifit1bl2 A C 19: 34,619,817 F133C possibly damaging Het
Itih2 T C 2: 10,108,894 probably benign Het
Itsn1 T C 16: 91,853,011 L191P probably benign Het
Kdr T C 5: 75,944,366 K1068R probably damaging Het
Lmtk2 T C 5: 144,182,756 L1345P probably damaging Het
Man2b2 T A 5: 36,809,041 D936V probably damaging Het
Mapk1ip1 G A 7: 138,836,588 R38* probably null Het
Med13l T C 5: 118,721,486 V246A possibly damaging Het
Mlec T A 5: 115,148,049 T248S probably benign Het
Mslnl T A 17: 25,737,902 V54D possibly damaging Het
Muc16 G A 9: 18,657,212 T1337I unknown Het
Nek7 C T 1: 138,515,654 S187N probably damaging Het
Neto2 A G 8: 85,640,585 V538A probably benign Het
Nktr T C 9: 121,750,136 probably benign Het
Npy6r A G 18: 44,276,492 K327E probably damaging Het
Olfr1230 T A 2: 89,297,024 D82V probably damaging Het
Olfr1245 T C 2: 89,575,672 D18G probably benign Het
Olfr1463 A T 19: 13,234,525 I92F probably benign Het
Olfr402 A G 11: 74,155,570 M139V possibly damaging Het
Olfr705 A G 7: 106,873,582 I221T probably damaging Het
Pcdhga4 A T 18: 37,687,425 N676Y probably damaging Het
Pde2a T C 7: 101,502,879 I331T possibly damaging Het
Pip5k1b A T 19: 24,304,035 Y486* probably null Het
Plch2 A G 4: 155,000,818 M272T probably benign Het
Rbm12 G A 2: 156,097,726 probably benign Het
Rgs19 T C 2: 181,689,507 E111G probably damaging Het
Rnf4 T A 5: 34,351,221 probably null Het
Rpa1 T C 11: 75,314,911 T207A probably damaging Het
Rufy4 A C 1: 74,129,397 Q113P probably damaging Het
Sh3pxd2b T G 11: 32,422,985 S717R probably benign Het
Sin3a A T 9: 57,107,540 I682F probably damaging Het
Sipa1l2 A T 8: 125,468,473 V842E possibly damaging Het
Slc5a4a A G 10: 76,147,597 I23V unknown Het
Slitrk5 A G 14: 111,681,725 N927S probably benign Het
Smc6 A G 12: 11,276,353 K117R possibly damaging Het
Sod2 G A 17: 13,008,031 probably benign Het
Stxbp1 A G 2: 32,796,018 I567T possibly damaging Het
Tbkbp1 C A 11: 97,147,380 L209F probably damaging Het
Tll1 G T 8: 64,038,586 probably null Het
Tmem38b T C 4: 53,840,765 L60S probably damaging Het
Trib1 G A 15: 59,654,475 R298H probably damaging Het
Trim30b A G 7: 104,366,142 V13A probably damaging Het
Trip11 G A 12: 101,889,742 T425I probably benign Het
Ttn C A 2: 76,889,973 probably benign Het
Tymp GC GCC 15: 89,374,364 probably null Het
Ush2a T A 1: 188,267,023 S177T probably damaging Het
Usp40 A T 1: 87,978,559 S651R probably benign Het
Vmn1r125 T C 7: 21,272,719 S181P probably damaging Het
Vmn1r198 T A 13: 22,354,758 V138D possibly damaging Het
Vmn1r56 A G 7: 5,196,318 L100P probably damaging Het
Vmn2r32 T A 7: 7,464,210 D773V probably benign Het
Vmn2r53 A C 7: 12,581,881 H670Q probably benign Het
Vmn2r69 A T 7: 85,406,503 I809N probably damaging Het
Wdr7 G A 18: 63,728,469 G184D probably damaging Het
Wnk1 C T 6: 120,037,601 G11D probably damaging Het
Zfp110 A C 7: 12,844,675 E171A possibly damaging Het
Zkscan6 T C 11: 65,815,931 V134A probably damaging Het
Other mutations in Rhbdf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01863:Rhbdf1 APN 11 32213484 missense probably benign
IGL02183:Rhbdf1 APN 11 32210543 missense probably damaging 1.00
IGL02793:Rhbdf1 APN 11 32213293 missense possibly damaging 0.92
IGL02875:Rhbdf1 APN 11 32213293 missense possibly damaging 0.92
FR4589:Rhbdf1 UTSW 11 32214391 unclassified probably benign
R0071:Rhbdf1 UTSW 11 32210498 missense probably damaging 1.00
R0180:Rhbdf1 UTSW 11 32210042 missense possibly damaging 0.76
R0512:Rhbdf1 UTSW 11 32210875 nonsense probably null
R0843:Rhbdf1 UTSW 11 32215053 missense probably damaging 1.00
R0880:Rhbdf1 UTSW 11 32213432 unclassified probably null
R1952:Rhbdf1 UTSW 11 32214277 nonsense probably null
R2017:Rhbdf1 UTSW 11 32210471 missense probably damaging 1.00
R2076:Rhbdf1 UTSW 11 32214088 missense probably benign 0.01
R3032:Rhbdf1 UTSW 11 32209985 missense probably damaging 1.00
R4355:Rhbdf1 UTSW 11 32216236 missense probably damaging 1.00
R4429:Rhbdf1 UTSW 11 32213369 missense probably benign 0.00
R4865:Rhbdf1 UTSW 11 32214517 missense probably damaging 1.00
R5585:Rhbdf1 UTSW 11 32210222 unclassified probably null
R5728:Rhbdf1 UTSW 11 32209901 unclassified probably null
R5925:Rhbdf1 UTSW 11 32212906 missense probably benign 0.24
R5940:Rhbdf1 UTSW 11 32209847 missense probably benign 0.00
R6088:Rhbdf1 UTSW 11 32212007 missense possibly damaging 0.62
R6361:Rhbdf1 UTSW 11 32212915 missense possibly damaging 0.92
R6692:Rhbdf1 UTSW 11 32215652 missense probably damaging 0.98
R6727:Rhbdf1 UTSW 11 32214042 missense possibly damaging 0.78
R6825:Rhbdf1 UTSW 11 32209970 missense probably damaging 1.00
R7589:Rhbdf1 UTSW 11 32212903 missense probably benign 0.01
V3553:Rhbdf1 UTSW 11 32211583 missense probably damaging 1.00
Z1176:Rhbdf1 UTSW 11 32215125 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TGTCCGTGAAAGGGATGCAG -3'
(R):5'- GTGCAGCCTCAGTAGCTTAGAG -3'

Posted On2017-07-14