Mutagenetix > Incidental Mutations

Incidental Mutation 'R6083:Trip11'

482326

Institutional Source

Beutler Lab

Gene Symbol

Trip11

Ensembl Gene

ENSMUSG00000021188

Gene Name

thyroid hormone receptor interactor 11

Synonyms

GMAP-210, 3110031G15Rik, 2610511G22Rik, 6030460N08Rik, TRIP230

MMRRC Submission

044242-MU

Accession Numbers

Genbank: NM_028446.1; Ensembl: ENSMUST00000021605, ENSMUST00000085086, ENSMUST00000110038

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6083 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

101834043-101913267 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 101889742 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 425 (T425I)

Ref Sequence

ENSEMBL: ENSMUSP00000135669 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021605] [ENSMUST00000176728] [ENSMUST00000177183] [ENSMUST00000177536]

Predicted Effect

probably benign
Transcript: ENSMUST00000021605
AA Change: T426I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000021605
Gene: ENSMUSG00000021188
AA Change: T426I

Domain	Start	End	E-Value	Type
low complexity region	2	26	N/A	INTRINSIC
coiled coil region	54	130	N/A	INTRINSIC
coiled coil region	167	194	N/A	INTRINSIC
coiled coil region	218	702	N/A	INTRINSIC
coiled coil region	754	990	N/A	INTRINSIC
coiled coil region	1022	1051	N/A	INTRINSIC
coiled coil region	1196	1261	N/A	INTRINSIC
low complexity region	1310	1322	N/A	INTRINSIC
coiled coil region	1336	1481	N/A	INTRINSIC
coiled coil region	1547	1657	N/A	INTRINSIC
coiled coil region	1681	1771	N/A	INTRINSIC
low complexity region	1934	1945	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000176728

SMART Domains

Protein: ENSMUSP00000134992
Gene: ENSMUSG00000021188

Domain	Start	End	E-Value	Type
low complexity region	2	26	N/A	INTRINSIC
Pfam:Orthopox_A5L	48	282	6.5e-9	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000177183

SMART Domains

Protein: ENSMUSP00000134976
Gene: ENSMUSG00000021188

Domain	Start	End	E-Value	Type
coiled coil region	33	158	N/A	INTRINSIC
coiled coil region	179	417	N/A	INTRINSIC
coiled coil region	469	705	N/A	INTRINSIC
coiled coil region	737	766	N/A	INTRINSIC
coiled coil region	911	976	N/A	INTRINSIC
low complexity region	1025	1037	N/A	INTRINSIC
coiled coil region	1051	1196	N/A	INTRINSIC
coiled coil region	1262	1372	N/A	INTRINSIC
coiled coil region	1396	1486	N/A	INTRINSIC
low complexity region	1649	1660	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000177536
AA Change: T425I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000135669
Gene: ENSMUSG00000021188
AA Change: T425I

Domain	Start	End	E-Value	Type
low complexity region	2	26	N/A	INTRINSIC
coiled coil region	53	129	N/A	INTRINSIC
coiled coil region	166	193	N/A	INTRINSIC
coiled coil region	217	517	N/A	INTRINSIC

Meta Mutation Damage Score

0.1256

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.6%

Validation Efficiency

96% (76/79)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified based on the interaction of its protein product with thyroid hormone receptor beta. This protein is associated with the Golgi apparatus. The N-terminal region of the protein binds Golgi membranes and the C-terminal region binds the minus ends of microtubules; thus, the protein is thought to play a role in assembly and maintenance of the Golgi ribbon structure around the centrosome. Mutations in this gene cause achondrogenesis type IA.[provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal lethality associated with small size, lung hypoplasia, omphalocele, and ventricular septal defects. [provided by MGI curators]

Allele List at MGI

All alleles(12) : Gene trapped(11) Chemically induced(1)

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810021J22Rik	C	A	11: 58,878,851	P73Q	possibly damaging	Het
Aak1	A	T	6: 86,963,996	I591F	unknown	Het
Ace	C	A	11: 105,985,267	Y816*	probably null	Het
Ahnak2	A	G	12: 112,782,612	V1205A	probably benign	Het
Ahnak2	T	G	12: 112,782,999	Q1076P	probably benign	Het
Ap2a1	G	A	7: 44,907,751	R263W	probably damaging	Het
Arhgap29	A	G	3: 121,992,748	T257A	probably benign	Het
Bora	A	T	14: 99,062,294	Q234L	possibly damaging	Het
Ccdc17	A	T	4: 116,596,926	Q47L	possibly damaging	Het
Cep170	C	T	1: 176,774,625	R305H	probably damaging	Het
Cyb5r4	C	T	9: 87,057,168	P335S	probably damaging	Het
Cyp2c54	A	G	19: 40,073,762	L17P	probably benign	Het
Cyp2c69	A	T	19: 39,849,456	V394E	probably damaging	Het
Dedd2	G	A	7: 25,211,290	P154S	probably benign	Het
Defb36	A	T	2: 152,604,488	M1L	unknown	Het
Dnaja1	A	G	4: 40,731,713	D263G	probably benign	Het
Dock10	T	C	1: 80,532,431	N1560S	probably damaging	Het
Efnb2	T	C	8: 8,622,328		probably null	Het
Eif3e	A	G	15: 43,266,144	I196T	probably damaging	Het
Ercc4	T	A	16: 13,110,039	C24*	probably null	Het
Fmn1	A	G	2: 113,364,303	E116G	unknown	Het
Gnas	A	G	2: 174,297,862	M1V	probably null	Het
Grin2a	C	A	16: 9,579,540	M894I	probably benign	Het
Herc2	G	T	7: 56,228,505	S4566I	probably benign	Het
Hmcn1	G	A	1: 150,755,293	P918L	probably damaging	Het
Hmcn1	G	T	1: 150,755,294	P918T	probably damaging	Het
Hsd3b2	T	A	3: 98,712,056	Y191F	possibly damaging	Het
Ifit1bl2	A	C	19: 34,619,817	F133C	possibly damaging	Het
Itih2	T	C	2: 10,108,894		probably benign	Het
Itsn1	T	C	16: 91,853,011	L191P	probably benign	Het
Kdr	T	C	5: 75,944,366	K1068R	probably damaging	Het
Lmtk2	T	C	5: 144,182,756	L1345P	probably damaging	Het
Man2b2	T	A	5: 36,809,041	D936V	probably damaging	Het
Mapk1ip1	G	A	7: 138,836,588	R38*	probably null	Het
Med13l	T	C	5: 118,721,486	V246A	possibly damaging	Het
Mlec	T	A	5: 115,148,049	T248S	probably benign	Het
Mslnl	T	A	17: 25,737,902	V54D	possibly damaging	Het
Muc16	G	A	9: 18,657,212	T1337I	unknown	Het
Nek7	C	T	1: 138,515,654	S187N	probably damaging	Het
Neto2	A	G	8: 85,640,585	V538A	probably benign	Het
Nktr	T	C	9: 121,750,136		probably benign	Het
Npy6r	A	G	18: 44,276,492	K327E	probably damaging	Het
Olfr1230	T	A	2: 89,297,024	D82V	probably damaging	Het
Olfr1245	T	C	2: 89,575,672	D18G	probably benign	Het
Olfr1463	A	T	19: 13,234,525	I92F	probably benign	Het
Olfr402	A	G	11: 74,155,570	M139V	possibly damaging	Het
Olfr705	A	G	7: 106,873,582	I221T	probably damaging	Het
Pcdhga4	A	T	18: 37,687,425	N676Y	probably damaging	Het
Pde2a	T	C	7: 101,502,879	I331T	possibly damaging	Het
Pip5k1b	A	T	19: 24,304,035	Y486*	probably null	Het
Plch2	A	G	4: 155,000,818	M272T	probably benign	Het
Rbm12	G	A	2: 156,097,726		probably benign	Het
Rgs19	T	C	2: 181,689,507	E111G	probably damaging	Het
Rhbdf1	T	C	11: 32,210,066	N145S	probably damaging	Het
Rnf4	T	A	5: 34,351,221		probably null	Het
Rpa1	T	C	11: 75,314,911	T207A	probably damaging	Het
Rufy4	A	C	1: 74,129,397	Q113P	probably damaging	Het
Sh3pxd2b	T	G	11: 32,422,985	S717R	probably benign	Het
Sin3a	A	T	9: 57,107,540	I682F	probably damaging	Het
Sipa1l2	A	T	8: 125,468,473	V842E	possibly damaging	Het
Slc5a4a	A	G	10: 76,147,597	I23V	unknown	Het
Slitrk5	A	G	14: 111,681,725	N927S	probably benign	Het
Smc6	A	G	12: 11,276,353	K117R	possibly damaging	Het
Sod2	G	A	17: 13,008,031		probably benign	Het
Stxbp1	A	G	2: 32,796,018	I567T	possibly damaging	Het
Tbkbp1	C	A	11: 97,147,380	L209F	probably damaging	Het
Tll1	G	T	8: 64,038,586		probably null	Het
Tmem38b	T	C	4: 53,840,765	L60S	probably damaging	Het
Trib1	G	A	15: 59,654,475	R298H	probably damaging	Het
Trim30b	A	G	7: 104,366,142	V13A	probably damaging	Het
Ttn	C	A	2: 76,889,973		probably benign	Het
Tymp	GC	GCC	15: 89,374,364		probably null	Het
Ush2a	T	A	1: 188,267,023	S177T	probably damaging	Het
Usp40	A	T	1: 87,978,559	S651R	probably benign	Het
Vmn1r125	T	C	7: 21,272,719	S181P	probably damaging	Het
Vmn1r198	T	A	13: 22,354,758	V138D	possibly damaging	Het
Vmn1r56	A	G	7: 5,196,318	L100P	probably damaging	Het
Vmn2r32	T	A	7: 7,464,210	D773V	probably benign	Het
Vmn2r53	A	C	7: 12,581,881	H670Q	probably benign	Het
Vmn2r69	A	T	7: 85,406,503	I809N	probably damaging	Het
Wdr7	G	A	18: 63,728,469	G184D	probably damaging	Het
Wnk1	C	T	6: 120,037,601	G11D	probably damaging	Het
Zfp110	A	C	7: 12,844,675	E171A	possibly damaging	Het
Zkscan6	T	C	11: 65,815,931	V134A	probably damaging	Het

Other mutations in Trip11

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00430:Trip11	APN	12	101886147	missense	probably benign	0.37
IGL00484:Trip11	APN	12	101885311	nonsense	probably null
IGL00972:Trip11	APN	12	101894337	missense	probably null	1.00
IGL01476:Trip11	APN	12	101898911	missense	probably damaging	0.96
IGL01591:Trip11	APN	12	101883345	missense	probably damaging	0.98
IGL01667:Trip11	APN	12	101878862	missense	probably damaging	1.00
IGL01764:Trip11	APN	12	101884631	missense	probably damaging	1.00
IGL01789:Trip11	APN	12	101871831	missense	probably benign	0.05
IGL01814:Trip11	APN	12	101884488	missense	probably damaging	0.98
IGL01898:Trip11	APN	12	101885676	missense	probably benign
IGL01924:Trip11	APN	12	101886884	missense	possibly damaging	0.93
IGL02020:Trip11	APN	12	101884313	missense	probably damaging	1.00
IGL02475:Trip11	APN	12	101895683	missense	probably benign	0.01
IGL02544:Trip11	APN	12	101893521	missense	probably damaging	1.00
IGL02678:Trip11	APN	12	101883390	missense	probably damaging	0.96
IGL02714:Trip11	APN	12	101884001	missense	probably damaging	1.00
IGL02718:Trip11	APN	12	101886025	missense	probably benign	0.24
IGL02904:Trip11	APN	12	101886838	missense	probably damaging	1.00
IGL03012:Trip11	APN	12	101883936	missense	probably damaging	1.00
IGL03191:Trip11	APN	12	101898925	missense	probably damaging	1.00
IGL03327:Trip11	APN	12	101883418	missense	possibly damaging	0.87
IGL03337:Trip11	APN	12	101885019	missense	probably damaging	1.00
NA:Trip11	UTSW	12	101894321	unclassified	probably null
R0027:Trip11	UTSW	12	101885169	missense	probably benign	0.00
R0028:Trip11	UTSW	12	101884757	missense	probably damaging	1.00
R0238:Trip11	UTSW	12	101884728	missense	probably damaging	1.00
R0238:Trip11	UTSW	12	101884728	missense	probably damaging	1.00
R0239:Trip11	UTSW	12	101884728	missense	probably damaging	1.00
R0239:Trip11	UTSW	12	101884728	missense	probably damaging	1.00
R0505:Trip11	UTSW	12	101885672	missense	probably damaging	0.98
R0556:Trip11	UTSW	12	101884518	nonsense	probably null
R0573:Trip11	UTSW	12	101886860	missense	probably benign	0.02
R0626:Trip11	UTSW	12	101885976	missense	possibly damaging	0.54
R1519:Trip11	UTSW	12	101886160	missense	probably benign	0.04
R1530:Trip11	UTSW	12	101912767	missense	unknown
R1647:Trip11	UTSW	12	101884392	nonsense	probably null
R1648:Trip11	UTSW	12	101884392	nonsense	probably null
R1856:Trip11	UTSW	12	101883333	nonsense	probably null
R2013:Trip11	UTSW	12	101837722	missense	probably damaging	1.00
R2017:Trip11	UTSW	12	101885360	missense	probably benign	0.00
R2206:Trip11	UTSW	12	101873442	missense	probably benign	0.25
R2207:Trip11	UTSW	12	101873442	missense	probably benign	0.25
R2304:Trip11	UTSW	12	101898977	missense	possibly damaging	0.58
R2328:Trip11	UTSW	12	101878827	makesense	probably null
R2513:Trip11	UTSW	12	101837727	missense	possibly damaging	0.94
R3499:Trip11	UTSW	12	101893694	missense	possibly damaging	0.87
R4105:Trip11	UTSW	12	101894322	nonsense	probably null
R4124:Trip11	UTSW	12	101895698	nonsense	probably null
R4126:Trip11	UTSW	12	101895698	nonsense	probably null
R4128:Trip11	UTSW	12	101895698	nonsense	probably null
R4175:Trip11	UTSW	12	101895698	nonsense	probably null
R4176:Trip11	UTSW	12	101895698	nonsense	probably null
R4181:Trip11	UTSW	12	101893768	missense	probably damaging	1.00
R4296:Trip11	UTSW	12	101885868	nonsense	probably null
R4302:Trip11	UTSW	12	101893768	missense	probably damaging	1.00
R4306:Trip11	UTSW	12	101886939	missense	probably benign
R4342:Trip11	UTSW	12	101884316	missense	probably damaging	1.00
R4576:Trip11	UTSW	12	101886240	nonsense	probably null
R4586:Trip11	UTSW	12	101883341	missense	possibly damaging	0.55
R4634:Trip11	UTSW	12	101837616	missense	probably damaging	1.00
R4696:Trip11	UTSW	12	101885290	missense	possibly damaging	0.71
R4792:Trip11	UTSW	12	101885446	missense	probably benign	0.10
R4903:Trip11	UTSW	12	101886806	critical splice donor site	probably null
R5001:Trip11	UTSW	12	101884910	nonsense	probably null
R5017:Trip11	UTSW	12	101846620	missense	probably benign	0.00
R5227:Trip11	UTSW	12	101884920	missense	probably damaging	1.00
R5231:Trip11	UTSW	12	101885601	missense	probably damaging	0.96
R5539:Trip11	UTSW	12	101885127	missense	probably damaging	0.98
R5754:Trip11	UTSW	12	101885665	nonsense	probably null
R5755:Trip11	UTSW	12	101885665	nonsense	probably null
R5890:Trip11	UTSW	12	101885972	missense	probably damaging	0.99
R5910:Trip11	UTSW	12	101883479	missense	probably damaging	1.00
R6208:Trip11	UTSW	12	101898895	missense	probably damaging	1.00
R6216:Trip11	UTSW	12	101890600	missense	probably benign	0.31
R6315:Trip11	UTSW	12	101885578	missense	possibly damaging	0.84
R6413:Trip11	UTSW	12	101885531	missense	probably benign	0.12
R6590:Trip11	UTSW	12	101885451	missense	possibly damaging	0.92
R6690:Trip11	UTSW	12	101885451	missense	possibly damaging	0.92
R6914:Trip11	UTSW	12	101846620	missense	probably benign	0.00
R6938:Trip11	UTSW	12	101837627	missense	probably damaging	0.98
R7015:Trip11	UTSW	12	101893683	missense	probably damaging	1.00
R7023:Trip11	UTSW	12	101885867	missense	probably benign	0.13
R7133:Trip11	UTSW	12	101884070	missense	probably damaging	0.97
R7271:Trip11	UTSW	12	101884352	missense	probably damaging	1.00
R7424:Trip11	UTSW	12	101885198	missense	probably damaging	1.00
R7431:Trip11	UTSW	12	101884019	missense	possibly damaging	0.84
R7472:Trip11	UTSW	12	101885380	missense	probably benign	0.00
R7491:Trip11	UTSW	12	101885435	missense	probably damaging	1.00
X0020:Trip11	UTSW	12	101885913	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- ATACTCTGAACCTTGCCCAGC -3'
(R):5'- GGACTAATTCTAAACTGTCCAACTG -3'

Posted On

2017-07-14