Incidental Mutation 'R6083:Tymp'
ID482334
Institutional Source Beutler Lab
Gene Symbol Tymp
Ensembl Gene ENSMUSG00000022615
Gene Namethymidine phosphorylase
Synonyms2900072D10Rik, PD-ECGF, gliostatin, Pdgfec, PDECGF, Ecgf1
MMRRC Submission 044242-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6083 (G1)
Quality Score217.468
Status Validated
Chromosome15
Chromosomal Location89371931-89377039 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) GC to GCC at 89374364 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000023285 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023285] [ENSMUST00000036987] [ENSMUST00000049968] [ENSMUST00000074552] [ENSMUST00000088717] [ENSMUST00000145259] [ENSMUST00000167643] [ENSMUST00000227834] [ENSMUST00000228111] [ENSMUST00000228977]
Predicted Effect probably null
Transcript: ENSMUST00000023285
SMART Domains Protein: ENSMUSP00000023285
Gene: ENSMUSG00000022615

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
Pfam:Glycos_trans_3N 23 85 1.5e-20 PFAM
Pfam:Glycos_transf_3 95 326 3.1e-50 PFAM
PYNP_C 374 448 6.46e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000036987
SMART Domains Protein: ENSMUSP00000036900
Gene: ENSMUSG00000008690

DomainStartEndE-ValueType
Pfam:DUF1032 20 576 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000049968
SMART Domains Protein: ENSMUSP00000053112
Gene: ENSMUSG00000047394

DomainStartEndE-ValueType
Pfam:SHIPPO-rpt 24 60 1.4e-4 PFAM
Pfam:SHIPPO-rpt 101 129 1.6e-3 PFAM
Pfam:SHIPPO-rpt 138 172 2.7e-6 PFAM
Pfam:SHIPPO-rpt 181 211 2.5e-5 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000074552
SMART Domains Protein: ENSMUSP00000074139
Gene: ENSMUSG00000008690

DomainStartEndE-ValueType
Pfam:DUF1032 51 607 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000088717
SMART Domains Protein: ENSMUSP00000086095
Gene: ENSMUSG00000008690

DomainStartEndE-ValueType
Pfam:CNDH2_N 11 123 1.2e-48 PFAM
Pfam:CNDH2_M 147 285 2.1e-20 PFAM
Pfam:CNDH2_C 308 598 1.9e-90 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134900
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136638
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140665
Predicted Effect probably benign
Transcript: ENSMUST00000145259
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147207
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147733
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151523
Predicted Effect probably benign
Transcript: ENSMUST00000167643
SMART Domains Protein: ENSMUSP00000131943
Gene: ENSMUSG00000091780

DomainStartEndE-ValueType
Pfam:SCO1-SenC 52 234 1.4e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226267
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227203
Predicted Effect probably benign
Transcript: ENSMUST00000227834
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227854
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228005
Predicted Effect probably benign
Transcript: ENSMUST00000228111
Predicted Effect probably benign
Transcript: ENSMUST00000228977
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 96% (76/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an angiogenic factor which promotes angiogenesis in vivo and stimulates the in vitro growth of a variety of endothelial cells. It has a highly restricted target cell specificity acting only on endothelial cells. Mutations in this gene have been associated with mitochondrial neurogastrointestinal encephalomyopathy. Multiple alternatively spliced transcript variants have been identified. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit reduced thymidine phosphorylase activity and increased thymidine levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik C A 11: 58,878,851 P73Q possibly damaging Het
Aak1 A T 6: 86,963,996 I591F unknown Het
Ace C A 11: 105,985,267 Y816* probably null Het
Ahnak2 A G 12: 112,782,612 V1205A probably benign Het
Ahnak2 T G 12: 112,782,999 Q1076P probably benign Het
Ap2a1 G A 7: 44,907,751 R263W probably damaging Het
Arhgap29 A G 3: 121,992,748 T257A probably benign Het
Bora A T 14: 99,062,294 Q234L possibly damaging Het
Ccdc17 A T 4: 116,596,926 Q47L possibly damaging Het
Cep170 C T 1: 176,774,625 R305H probably damaging Het
Cyb5r4 C T 9: 87,057,168 P335S probably damaging Het
Cyp2c54 A G 19: 40,073,762 L17P probably benign Het
Cyp2c69 A T 19: 39,849,456 V394E probably damaging Het
Dedd2 G A 7: 25,211,290 P154S probably benign Het
Defb36 A T 2: 152,604,488 M1L unknown Het
Dnaja1 A G 4: 40,731,713 D263G probably benign Het
Dock10 T C 1: 80,532,431 N1560S probably damaging Het
Efnb2 T C 8: 8,622,328 probably null Het
Eif3e A G 15: 43,266,144 I196T probably damaging Het
Ercc4 T A 16: 13,110,039 C24* probably null Het
Fmn1 A G 2: 113,364,303 E116G unknown Het
Gnas A G 2: 174,297,862 M1V probably null Het
Grin2a C A 16: 9,579,540 M894I probably benign Het
Herc2 G T 7: 56,228,505 S4566I probably benign Het
Hmcn1 G A 1: 150,755,293 P918L probably damaging Het
Hmcn1 G T 1: 150,755,294 P918T probably damaging Het
Hsd3b2 T A 3: 98,712,056 Y191F possibly damaging Het
Ifit1bl2 A C 19: 34,619,817 F133C possibly damaging Het
Itih2 T C 2: 10,108,894 probably benign Het
Itsn1 T C 16: 91,853,011 L191P probably benign Het
Kdr T C 5: 75,944,366 K1068R probably damaging Het
Lmtk2 T C 5: 144,182,756 L1345P probably damaging Het
Man2b2 T A 5: 36,809,041 D936V probably damaging Het
Mapk1ip1 G A 7: 138,836,588 R38* probably null Het
Med13l T C 5: 118,721,486 V246A possibly damaging Het
Mlec T A 5: 115,148,049 T248S probably benign Het
Mslnl T A 17: 25,737,902 V54D possibly damaging Het
Muc16 G A 9: 18,657,212 T1337I unknown Het
Nek7 C T 1: 138,515,654 S187N probably damaging Het
Neto2 A G 8: 85,640,585 V538A probably benign Het
Nktr T C 9: 121,750,136 probably benign Het
Npy6r A G 18: 44,276,492 K327E probably damaging Het
Olfr1230 T A 2: 89,297,024 D82V probably damaging Het
Olfr1245 T C 2: 89,575,672 D18G probably benign Het
Olfr1463 A T 19: 13,234,525 I92F probably benign Het
Olfr402 A G 11: 74,155,570 M139V possibly damaging Het
Olfr705 A G 7: 106,873,582 I221T probably damaging Het
Pcdhga4 A T 18: 37,687,425 N676Y probably damaging Het
Pde2a T C 7: 101,502,879 I331T possibly damaging Het
Pip5k1b A T 19: 24,304,035 Y486* probably null Het
Plch2 A G 4: 155,000,818 M272T probably benign Het
Rbm12 G A 2: 156,097,726 probably benign Het
Rgs19 T C 2: 181,689,507 E111G probably damaging Het
Rhbdf1 T C 11: 32,210,066 N145S probably damaging Het
Rnf4 T A 5: 34,351,221 probably null Het
Rpa1 T C 11: 75,314,911 T207A probably damaging Het
Rufy4 A C 1: 74,129,397 Q113P probably damaging Het
Sh3pxd2b T G 11: 32,422,985 S717R probably benign Het
Sin3a A T 9: 57,107,540 I682F probably damaging Het
Sipa1l2 A T 8: 125,468,473 V842E possibly damaging Het
Slc5a4a A G 10: 76,147,597 I23V unknown Het
Slitrk5 A G 14: 111,681,725 N927S probably benign Het
Smc6 A G 12: 11,276,353 K117R possibly damaging Het
Sod2 G A 17: 13,008,031 probably benign Het
Stxbp1 A G 2: 32,796,018 I567T possibly damaging Het
Tbkbp1 C A 11: 97,147,380 L209F probably damaging Het
Tll1 G T 8: 64,038,586 probably null Het
Tmem38b T C 4: 53,840,765 L60S probably damaging Het
Trib1 G A 15: 59,654,475 R298H probably damaging Het
Trim30b A G 7: 104,366,142 V13A probably damaging Het
Trip11 G A 12: 101,889,742 T425I probably benign Het
Ttn C A 2: 76,889,973 probably benign Het
Ush2a T A 1: 188,267,023 S177T probably damaging Het
Usp40 A T 1: 87,978,559 S651R probably benign Het
Vmn1r125 T C 7: 21,272,719 S181P probably damaging Het
Vmn1r198 T A 13: 22,354,758 V138D possibly damaging Het
Vmn1r56 A G 7: 5,196,318 L100P probably damaging Het
Vmn2r32 T A 7: 7,464,210 D773V probably benign Het
Vmn2r53 A C 7: 12,581,881 H670Q probably benign Het
Vmn2r69 A T 7: 85,406,503 I809N probably damaging Het
Wdr7 G A 18: 63,728,469 G184D probably damaging Het
Wnk1 C T 6: 120,037,601 G11D probably damaging Het
Zfp110 A C 7: 12,844,675 E171A possibly damaging Het
Zkscan6 T C 11: 65,815,931 V134A probably damaging Het
Other mutations in Tymp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01013:Tymp APN 15 89376310 missense probably damaging 1.00
IGL03355:Tymp APN 15 89375016 missense possibly damaging 0.80
PIT4142001:Tymp UTSW 15 89376345 missense probably damaging 1.00
R0791:Tymp UTSW 15 89374818 missense probably damaging 1.00
R2219:Tymp UTSW 15 89374762 missense probably benign
R2266:Tymp UTSW 15 89373808 missense probably damaging 1.00
R2267:Tymp UTSW 15 89373808 missense probably damaging 1.00
R2268:Tymp UTSW 15 89373808 missense probably damaging 1.00
R4714:Tymp UTSW 15 89376307 missense probably damaging 1.00
R5247:Tymp UTSW 15 89374364 frame shift probably null
R5248:Tymp UTSW 15 89374364 frame shift probably null
R5249:Tymp UTSW 15 89374364 frame shift probably null
R5741:Tymp UTSW 15 89376436 missense probably benign 0.18
R5810:Tymp UTSW 15 89374331 missense probably damaging 0.99
R5960:Tymp UTSW 15 89376575 critical splice donor site probably null
R6082:Tymp UTSW 15 89374364 frame shift probably null
R6085:Tymp UTSW 15 89374364 frame shift probably null
R6566:Tymp UTSW 15 89373600 missense probably benign
R6869:Tymp UTSW 15 89376691 missense probably benign
R6969:Tymp UTSW 15 89374048 missense probably benign 0.04
R7019:Tymp UTSW 15 89376281 synonymous probably null
Z1177:Tymp UTSW 15 89375564 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGAAGCTGCAGGGATTG -3'
(R):5'- TCCAATCAAAGCTGTCCTGAC -3'

Posted On2017-07-14